Richard Lab:Bio-Brick Formats
From OpenWetWare
Back to Protocols
Introduction
In general the Richard Lab uses the standard Bio-Brick format. However occasionally this format is incompatible with our goals (e.g. making protein fusions) or is unnecessarilly cumbersome (e.g. PCR overlap extension).
Formats
Biobrick Standard
This standard uses the typical biobrick assembly enzymes [EcoRI (GAATTC), XbaI (TCTAGA), SpeI (ACTAGT), and PstI (CTGCAG)] as well as NotI sites (GCGGCCGC) flanking the part. There is a slightly different prefix for protein coding parts to put the start codon in a better spot in relation to the RBS.
- Prefix
- GAATTC'gcggccgc'tTCTAGAg
- The EcoRI and XbaI sites are in caps while the NotI site is in bold.
- Protein Coding Prefix
- GAATTCgcggccgctTCTAG
- using this prefix the first base of the start codon (i.e. the "A" in "ATG") will complete the XbaI site.
- Suffix
- tactagtagcggccgctgcag
Short Biobrick
Protein Fusions
Back to Protocols