Richard Lab:qPCR
From OpenWetWare
(→Analysis) |
(→Analysis) |
||
| Line 61: | Line 61: | ||
==Analysis== | ==Analysis== | ||
| - | *Comparative analysis of qPCR data is usually based on | + | *Comparative analysis of qPCR data is usually based on C<sub>T</sub> (the cycle at which a given sample reaches some threshhold value of DNA fluorescence). |
| - | *The | + | *The C<sub>T</sub> can be chosen by the user, but is typically close to the point when the sample fluroescence elevates above background levels. |
===As Percentage of Total DNA=== | ===As Percentage of Total DNA=== | ||
| - | *Using this method the | + | *Using this method the C<sub>T</sub> of a sample is compared to the C<sub>T</sub> values of a standard curve of DNA from a pure culture. |
*By comparing the amount of DNA added to the sample to the amounts of DNA in the standard cuve, the "percentage of total DNA" can be calculated. | *By comparing the amount of DNA added to the sample to the amounts of DNA in the standard cuve, the "percentage of total DNA" can be calculated. | ||
| - | *Results typically feel like, "There were 10ng of DNA added to this well, but the | + | *Results typically feel like, "There were 10ng of DNA added to this well, but the C<sub>T</sub> is the same as the C<sub>T</sub> of the well containg 1ng of pure culture DNA; so our target DNA is 10% of the total DNA". |
*The difficulty of this method lies in the replicability of DNA extraction from samples (especially plant samples like silage). Often extra plant DNA can be extracted very differently from one sample to another. Further complicating the matter is gleaning useful meaning from this "percentage of total DNA" output. | *The difficulty of this method lies in the replicability of DNA extraction from samples (especially plant samples like silage). Often extra plant DNA can be extracted very differently from one sample to another. Further complicating the matter is gleaning useful meaning from this "percentage of total DNA" output. | ||
| - | ===Using the 2<sup>- | + | ===Using the 2<sup>-ΔΔC<sub>T</sub></sup> Method=== |
===Using the Pfaffl Comparison Method=== | ===Using the Pfaffl Comparison Method=== | ||
==References== | ==References== | ||
Revision as of 10:50, 15 September 2011
Back to PCR protocols
Back to Protocols
Contents |
Introduction
Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample. This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well. RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels. For more information on qPCR and its uses, please see the qPCR hub page or the PCR hub page.
Equipment
- The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use. To access these systems you will need to in, and sign up on their calendar "CoreCal".
- To run your sample you'll need a 96 well optical plate with a half skirt (AB part #N801-0560) and an optical film to cover it. You can purchase these directly from the core facility.
DNA Preparation
- Your DNA can be extracted from any sample. We commonly use a kit for this purpose, but there are a variety of methods around to extract DNA from many materials.
- An important consideration is that the DNA is free of humic acids, which are common contaminants of dna extracted from soil or silage samples. Humic acids will screw up your qPCR.
- Typically 1-20ng of DNA will be added to each (20μL) reaction. This will generally involve diluting your DNA.
Primers
To design primers you should probably use a computer program. It is also important to make sure that their products are the same legnth if you're going to be comparing different populations. We use the following primers on a regular basis to identify specific populations:
- Quantification of total bacteria:
- Ftot - GCAGGCCTAACACATGCAAGTC
- Rtot - CTGCTGCCTCCCGTAGGAGT
- Quantification of Lactobacillus spp.
- Flac - GCAGCAGTAGGGAATCTTCCA
- Rlac - GCATTYCACCGCTACACATG
- Quantification of Ferulic acid esterase gene from Lactobacillus jonhsonii
- Ffae - TTAAAACAGATCCGCATGTACGTAA
- Rfae - AGCCCAGCTAACATTGAAGCA
PCR Mix
While there are many commercial 2X PCR mixes to choose from, a cheap and easy homemade stock is really useful for most applications.
2X SYBR Mix
This recipe is to make 1ml of 2X qPCR master mix using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.
- 730μL Water
- 200μL Thermopol Buffer (with Mg2+)
- 50μL dNTPs
- 10μL Taq DNA Polymerase (~15 units)
- 7μL each primer (100μM)
- 3μL SYBR Green II (100x)
Taqman Mix
You can also make a similar mix using a taqman probe instead of SYBR green. While the probes are expensive (over $100 each), they can lead to more reliable results, and eliminate the need for normalization based on the amplification product length when doing comparisons.
Running the sample
- 1. Keep the master mix and your sample apart until immediately before running.
- 2. Dilute a portion of your samples to have a DNA concentration of 0.1-2ng/μL.
- 3. Place 10μL of the diluted samples in each well in the plate.
- 4. Lightly put the optical film over the plate.
- 5. Take your prepped plate and your 2X master mix (in a tube on ice) down to the core facility.
- 6. Start up the machine.
- 7. Set up the following program.
- Detector = SYBR, Rox = NO
- 95°C for 10 min
- 95°C for 20sec
- 60°C for 60 sec
- Repeat the two-step cycle 45x
- If you want to, you can do a melt curve to be sure that your primers are only amplifying one thing.
- Ramp from 50.0°C to 95.0°C
- Read every 0.2°C h
- Hold 00:00:02 between reads
- 8. Add 10μL of 2X mix to each well (using a multi pipettor for this makes it much easier).
- 9. Quickly centrifuge the plate.
- 10. Place it in the machine and Run the program (you will need to save it first):
Analysis
- Comparative analysis of qPCR data is usually based on CT (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).
- The CT can be chosen by the user, but is typically close to the point when the sample fluroescence elevates above background levels.
As Percentage of Total DNA
- Using this method the CT of a sample is compared to the CT values of a standard curve of DNA from a pure culture.
- By comparing the amount of DNA added to the sample to the amounts of DNA in the standard cuve, the "percentage of total DNA" can be calculated.
- Results typically feel like, "There were 10ng of DNA added to this well, but the CT is the same as the CT of the well containg 1ng of pure culture DNA; so our target DNA is 10% of the total DNA".
- The difficulty of this method lies in the replicability of DNA extraction from samples (especially plant samples like silage). Often extra plant DNA can be extracted very differently from one sample to another. Further complicating the matter is gleaning useful meaning from this "percentage of total DNA" output.


