Richard Lab:qPCR

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (01:46, 20 February 2012) (view source)
(2X SYBR Mix)
(39 intermediate revisions not shown.)
Line 3: Line 3:
Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample.  This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well.  RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels.  For more information on qPCR and its uses, please see the [[Real-time PCR|qPCR hub page]] or the [[PCR techniques|PCR hub page]].
Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample.  This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well.  RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels.  For more information on qPCR and its uses, please see the [[Real-time PCR|qPCR hub page]] or the [[PCR techniques|PCR hub page]].
*The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use.  To access these systems you will need to [|log in], and sign up on their calendar "CoreCal".
*The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use.  To access these systems you will need to [|log in], and sign up on their calendar "CoreCal".
Line 14: Line 14:
To design primers you should probably use a computer program.  It is also important to make sure that their products are the same legnth if you're going to be comparing different populations.  We use the following primers on a regular basis to identify specific populations:
To design primers you should probably use a computer program.  With the programs suggestions it is important to run a [ primer BLAST] to check for non-specific binding.  It is also important to make sure that their products are the same length if you're going to be comparing different populations using SYBR green.  For considerations on how to choose which primers to use, see the analysis section.  We use the following primers on a regular basis to identify specific populations:
*'''Quantification of total bacteria:'''**Ftot - GCAGGCCTAACACATGCAAGTC
*'''Quantification of total bacteria:'''
*Quantification of ''Lactobacillus'' spp.
*'''Quantification of ''Lactobacillus'' spp.'''
*Quantification of Ferulic acid esterase gene from ''Lactobacillus jonhsonii''
*'''Quantification of Ferulic acid esterase gene from ''Lactobacillus jonhsonii'''''
Line 28: Line 29:
===2X SYBR Mix===     
===2X SYBR Mix===     
This recipe is to make 1ml of '''2X qPCR master mix''' using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs.  This mix is enough to make an entire 96 well plate of 20μL qPCR reactions.  After this mix is prepared it should be kept on ice until use.   
This recipe is to make 1ml of '''2X qPCR master mix''' using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs.  This mix is enough to make an entire 96 well plate of 20μL qPCR reactions.  After this mix is prepared it should be kept on ice until use.   
:*730μL Water
:*705μL Water
:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)
:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)
:*50μL dNTPs
:*25μL dNTP mix (10mM each)
:*40μL ROX dye (see note)
:*10μL Taq DNA Polymerase (~15 units)
:*10μL Taq DNA Polymerase (~15 units)
:*7μL each primer (100μM)
:*5μL each primer (100μM)
:*3μL SYBR Green II (100x)
:*10μL SYBR Green II (100x)
*ROX is supplied in a 25μM stock solution.  The 40μL listed above is the amount used for Applied Biosystems 7000, 7300, 7700, 7900HT, StepOne, and PRISM models.  If using an AB 7500 only use 1/10 the amount of ROX suggested here.
*If not using ROX (or using less ROX) substitute the remaining volume with water.
===Taqman Mix===
===Taqman Mix===
You can also make a similar mix using a taqman probe instead of SYBR green. While the probes are expensive (over $100 each), they can lead to more reliable results, and eliminate the need for normalization based on the amplification product length when doing comparisons.
You can also make a similar mix using a taqman probe instead of SYBR green. While the probes are expensive (over $100 each), they can lead to more reliable results, and eliminate the need for normalization based on the amplicon length when doing comparisons.
==Running the sample==
==Running the sample==
*Keep the master mix and your sample apart until immediately before running.
:1. Keep the master mix and your sample apart until immediately before running.
*After diluting your sample to contain 0.1-2ng/μL place 10μL of the diluted samples in each well in the plate.
:2. Dilute a portion of your samples to have a DNA concentration of 0.1-2ng/μL.
*Immediately before running, add 10μL of 2X mix to each well (using a multi pipettor for this makes it much easier).
:3. Place 10μL of the diluted samples in each well in the plate.
*Run the following program:
:4. Lightly put the optical film over the plate.
**95°C for 10 min
:5. Take your prepped plate and your 2X master mix (in a tube on ice) down to the core facility.
***95°C for 20sec
:6. Start up the machine.
***60°C for 60 sec
:7. Set up the following program.
**Repeat the two-step cycle 45x
::*Detector = SYBR, Rox = Yes (but only if you added it)
*If you want to, you can do a melt curve to be sure that your primers are only amplifying one thing.
::*95°C for 10 min
**Ramp from 50.0°C to 95.0°C  
::**95°C for 20sec
***Read every 0.2°C h
::**60°C for 60 sec
***Hold 00:00:02 between reads
::*Repeat the two-step cycle 45x
::*If you want to, you can do a melt curve to be sure that your primers are only amplifying one thing.
::**Ramp from 50.0°C to 95.0°C  
::**Read every 0.2°C h
::**Hold 00:00:02 between reads
:8. Add 10μL of 2X mix to each well (using a multi pipettor for this makes it much easier). 
:9. Quickly centrifuge the plate.
:10. Place it in the machine and Run the program (you will need to save it first):
*Comparative analysis of qPCR data is usually based on C<sub>T</sub> (the cycle at which a given sample reaches some threshhold value of DNA fluorescence). 
*The threshold for C<sub>T</sub> can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.
*In general, the ratio between two C<sub>T</sub>'s in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration.  So the analysis methods are used primarily to compare two different C<sub>T</sub>'s between different samples, or to compare many samples to one reference sample.  This provides much more in the way of interesting data.  An example would be thus:  "In sample A, the C<sub>T</sub> of population 1 is 2.5 higher than the C<sub>T</sub> of population 2, but in the control sample the C<sub>T</sub>'s are nearly equal."  The 2<sup>-ΔΔC<sub>T</sub></sup> method allows us to more precisely quantify this change.
===As Percentage of Total DNA===
Using this method the C<sub>T</sub> of a sample is compared to the C<sub>T</sub> values of a standard curve of DNA from a pure culture. 
*By comparing the amount of DNA added to the sample to the amounts of DNA in the standard cuve, the "percentage of total DNA" can be calculated.
*Results typically feel like, "There were 10ng of DNA added to this well, but the C<sub>T</sub> is the same as the C<sub>T</sub> of the well containg 1ng of pure culture DNA; so our target DNA is 10% of the total DNA".
*The difficulty of this method lies in the replicability of DNA extraction from samples (especially plant samples like silage).  Often extra plant DNA can be extracted very differently from one sample to another.  Further complicating the matter is gleaning useful meaning from this "percentage of total DNA" output.
===Using the 2<sup>-ΔΔC<sub>T</sub></sup> Method===
This method uses a second set of primers which anneal to a greater population of DNA as an reference.  This eliminates the vagueness of the total DNA method and the error introduced by differential DNA extraction. 
*The amount of the target DNA relative to the reference DNA is 2<sup>-ΔC<sub>T</sub></sup> where ΔC<sub>T</sub> = ΔC<sub>T, target</sub> - ΔC<sub>T, reference</sub>.
*Typical output feels like "My population is 25% percent of the total bacterial population".
*You actually still have to make a standard curve (and sometimes more than one) for two reasons:
:1. To be sure that your two primer pairs are amplifying at the same efficiency.
::*The ΔC<sub>T</sub> values should be approximately the same for all dilutions.
::*This standard curve can be done with DNA from any sample and need not necessarilly be from a pure culture.
:2. To calibrate the relationship between the two amplicons.
::*If your comparing a one copy gene (like an enzyme) to a many copy gene (like rRNA genes) then a numerical relationship needs to be established between them. 
::*If your amplicons are different lengths then this will also be taken care of in this calibration.
::*Sometimes it helps to use a DNA from pure cultures of different genera to determine this relationship if that's important to you.
===Using the Pfaffl Method===
*This is the prefered method as it corrects for differences in PCR efficiency as well as amplicon length without calibration.
*You should probably run a dilution just to see if your values jive.
*This method could be used to measure differential gene expression as well as comparative populations.
1. Definitions:
::*Target - The population you're trying to quantify
::*Reference - The population you're comparing it to
::*Control - A treatment for which you are measuring both target and reference populations
::*Sample - A treatment for which you are measuring both target and reference populations comparing to the control treatment
2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:
::*Efficiency = E = 10<sup>-1/slope</sup>.
::*This is the major difference with the previous method, and corrects for differences in amplicon length as well as copy number.
::*The slope of different dilutions (if you made any) should be the same.
3. Define the ΔCt for target and reference populations (the Pfaffl paper uses "CP" instead of Ct).
::*ΔCt<sub>target</sub> = Control Ct<sub>target</sub> - Sample Ct<sub>target</sub>.
::*ΔCt<sub>reference</sub> = Control Ct<sub>reference</sub> - Sample Ct<sub>reference</sub>.
4. Compare the sample to the control using the ΔCt's
::*Ratio = (E<sub>target</sub>)<sup>ΔCt<sub>target</sub></sup> / (E<sub>reference</sub>)<sup>ΔCt<sub>reference</sub></sup>
::*This is the ratio of the target in the sample to the target in the control, using the reaction effiency (E) and the reference levels to normalize.

Current revision

Back to PCR protocols
Back to Protocols



Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample. This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well. RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels. For more information on qPCR and its uses, please see the qPCR hub page or the PCR hub page.


  • The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use. To access these systems you will need to in, and sign up on their calendar "CoreCal".
  • To run your sample you'll need a 96 well optical plate with a half skirt (AB part #N801-0560) and an optical film to cover it. You can purchase these directly from the core facility.

DNA Preparation

  • Your DNA can be extracted from any sample. We commonly use a kit for this purpose, but there are a variety of methods around to extract DNA from many materials.
  • An important consideration is that the DNA is free of humic acids, which are common contaminants of dna extracted from soil or silage samples. Humic acids will screw up your qPCR.
  • Typically 1-20ng of DNA will be added to each (20μL) reaction. This will generally involve diluting your DNA.


To design primers you should probably use a computer program. With the programs suggestions it is important to run a primer BLAST to check for non-specific binding. It is also important to make sure that their products are the same length if you're going to be comparing different populations using SYBR green. For considerations on how to choose which primers to use, see the analysis section. We use the following primers on a regular basis to identify specific populations:

  • Quantification of total bacteria:
  • Quantification of Lactobacillus spp.
  • Quantification of Ferulic acid esterase gene from Lactobacillus jonhsonii


While there are many commercial 2X PCR mixes to choose from, a cheap and easy homemade stock is really useful for most applications.


This recipe is to make 1ml of 2X qPCR master mix using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.

  • 705μL Water
  • 200μL Thermopol Buffer (with Mg2+)
  • 25μL dNTP mix (10mM each)
  • 40μL ROX dye (see note)
  • 10μL Taq DNA Polymerase (~15 units)
  • 5μL each primer (100μM)
  • 10μL SYBR Green II (100x)


  • ROX is supplied in a 25μM stock solution. The 40μL listed above is the amount used for Applied Biosystems 7000, 7300, 7700, 7900HT, StepOne, and PRISM models. If using an AB 7500 only use 1/10 the amount of ROX suggested here.
  • If not using ROX (or using less ROX) substitute the remaining volume with water.

Taqman Mix

You can also make a similar mix using a taqman probe instead of SYBR green. While the probes are expensive (over $100 each), they can lead to more reliable results, and eliminate the need for normalization based on the amplicon length when doing comparisons.

Running the sample

1. Keep the master mix and your sample apart until immediately before running.
2. Dilute a portion of your samples to have a DNA concentration of 0.1-2ng/μL.
3. Place 10μL of the diluted samples in each well in the plate.
4. Lightly put the optical film over the plate.
5. Take your prepped plate and your 2X master mix (in a tube on ice) down to the core facility.
6. Start up the machine.
7. Set up the following program.
  • Detector = SYBR, Rox = Yes (but only if you added it)
  • 95°C for 10 min
    • 95°C for 20sec
    • 60°C for 60 sec
  • Repeat the two-step cycle 45x
  • If you want to, you can do a melt curve to be sure that your primers are only amplifying one thing.
    • Ramp from 50.0°C to 95.0°C
    • Read every 0.2°C h
    • Hold 00:00:02 between reads
8. Add 10μL of 2X mix to each well (using a multi pipettor for this makes it much easier).
9. Quickly centrifuge the plate.
10. Place it in the machine and Run the program (you will need to save it first):


  • Comparative analysis of qPCR data is usually based on CT (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).
  • The threshold for CT can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.
  • In general, the ratio between two CT's in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration. So the analysis methods are used primarily to compare two different CT's between different samples, or to compare many samples to one reference sample. This provides much more in the way of interesting data. An example would be thus: "In sample A, the CT of population 1 is 2.5 higher than the CT of population 2, but in the control sample the CT's are nearly equal." The 2-ΔΔCT method allows us to more precisely quantify this change.

As Percentage of Total DNA

Using this method the CT of a sample is compared to the CT values of a standard curve of DNA from a pure culture.

  • By comparing the amount of DNA added to the sample to the amounts of DNA in the standard cuve, the "percentage of total DNA" can be calculated.
  • Results typically feel like, "There were 10ng of DNA added to this well, but the CT is the same as the CT of the well containg 1ng of pure culture DNA; so our target DNA is 10% of the total DNA".
  • The difficulty of this method lies in the replicability of DNA extraction from samples (especially plant samples like silage). Often extra plant DNA can be extracted very differently from one sample to another. Further complicating the matter is gleaning useful meaning from this "percentage of total DNA" output.

Using the 2-ΔΔCT Method

This method uses a second set of primers which anneal to a greater population of DNA as an reference. This eliminates the vagueness of the total DNA method and the error introduced by differential DNA extraction.

  • The amount of the target DNA relative to the reference DNA is 2-ΔCT where ΔCT = ΔCT, target - ΔCT, reference.
  • Typical output feels like "My population is 25% percent of the total bacterial population".
  • You actually still have to make a standard curve (and sometimes more than one) for two reasons:
1. To be sure that your two primer pairs are amplifying at the same efficiency.
  • The ΔCT values should be approximately the same for all dilutions.
  • This standard curve can be done with DNA from any sample and need not necessarilly be from a pure culture.
2. To calibrate the relationship between the two amplicons.
  • If your comparing a one copy gene (like an enzyme) to a many copy gene (like rRNA genes) then a numerical relationship needs to be established between them.
  • If your amplicons are different lengths then this will also be taken care of in this calibration.
  • Sometimes it helps to use a DNA from pure cultures of different genera to determine this relationship if that's important to you.

Using the Pfaffl Method

  • This is the prefered method as it corrects for differences in PCR efficiency as well as amplicon length without calibration.
  • You should probably run a dilution just to see if your values jive.
  • This method could be used to measure differential gene expression as well as comparative populations.

1. Definitions:

  • Target - The population you're trying to quantify
  • Reference - The population you're comparing it to
  • Control - A treatment for which you are measuring both target and reference populations
  • Sample - A treatment for which you are measuring both target and reference populations comparing to the control treatment

2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:

  • Efficiency = E = 10-1/slope.
  • This is the major difference with the previous method, and corrects for differences in amplicon length as well as copy number.
  • The slope of different dilutions (if you made any) should be the same.

3. Define the ΔCt for target and reference populations (the Pfaffl paper uses "CP" instead of Ct).

  • ΔCttarget = Control Cttarget - Sample Cttarget.
  • ΔCtreference = Control Ctreference - Sample Ctreference.

4. Compare the sample to the control using the ΔCt's

  • Ratio = (Etarget)ΔCttarget / (Ereference)ΔCtreference
  • This is the ratio of the target in the sample to the target in the control, using the reaction effiency (E) and the reference levels to normalize.


Personal tools