Richard Lab:qPCR - Revision history

Michael A. Speer: /* 2X SYBR Mix */

2012-02-20T05:46:35Z

2X SYBR Mix

←Older revision		Revision as of 05:46, 20 February 2012
Line 29:		Line 29:
	===2X SYBR Mix===		===2X SYBR Mix===
	This recipe is to make 1ml of '''2X qPCR master mix''' using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.		This recipe is to make 1ml of '''2X qPCR master mix''' using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.
-	:*~~715μL~~ Water	+	:*705μL Water
	:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)		:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)
	:*25μL dNTP mix (10mM each)		:*25μL dNTP mix (10mM each)
	:*40μL ROX dye (see note)		:*40μL ROX dye (see note)
	:*10μL Taq DNA Polymerase (~15 units)		:*10μL Taq DNA Polymerase (~15 units)
-	:*~~7μL~~ each primer (100μM)	+	:*5μL each primer (100μM)
-	:*~~3μL~~ SYBR Green II (100x)	+	:*10μL SYBR Green II (100x)
		+
	====Notes====		====Notes====
	*ROX is supplied in a 25μM stock solution. The 40μL listed above is the amount used for Applied Biosystems 7000, 7300, 7700, 7900HT, StepOne, and PRISM models. If using an AB 7500 only use 1/10 the amount of ROX suggested here.		*ROX is supplied in a 25μM stock solution. The 40μL listed above is the amount used for Applied Biosystems 7000, 7300, 7700, 7900HT, StepOne, and PRISM models. If using an AB 7500 only use 1/10 the amount of ROX suggested here.

Michael A. Speer: /* 2X SYBR Mix */

2012-02-20T05:36:02Z

2X SYBR Mix

←Older revision		Revision as of 05:36, 20 February 2012
Line 29:		Line 29:
	===2X SYBR Mix===		===2X SYBR Mix===
	This recipe is to make 1ml of '''2X qPCR master mix''' using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.		This recipe is to make 1ml of '''2X qPCR master mix''' using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.
-	:*~~690μL~~ Water	+	:*715μL Water
	:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)		:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)
-	:*~~50μL~~ dNTP mix (10mM each)	+	:*25μL dNTP mix (10mM each)
	:*40μL ROX dye (see note)		:*40μL ROX dye (see note)
	:*10μL Taq DNA Polymerase (~15 units)		:*10μL Taq DNA Polymerase (~15 units)

Michael A. Speer: /* 2X SYBR Mix */

2012-02-20T05:25:41Z

2X SYBR Mix

←Older revision		Revision as of 05:25, 20 February 2012
Line 31:		Line 31:
	:*690μL Water		:*690μL Water
	:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)		:*200μL Thermopol Buffer (with Mg<sup>2+</sup>)
-	:*50μL ~~dNTPs~~	+	:*50μL dNTP mix (10mM each)
	:*40μL ROX dye (see note)		:*40μL ROX dye (see note)
	:*10μL Taq DNA Polymerase (~15 units)		:*10μL Taq DNA Polymerase (~15 units)

Michael A. Speer: /* Using the Pfaffl Method */

2011-10-13T13:44:10Z

Using the Pfaffl Method

←Older revision		Revision as of 13:44, 13 October 2011
Line 100:		Line 100:
	2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:		2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:
	::*Efficiency = E = 10<sup>-1/slope</sup>.		::*Efficiency = E = 10<sup>-1/slope</sup>.
-	::*This is the major difference with the previous method.	+	::*This is the major difference with the previous method, and corrects for differences in amplicon length as well as copy number.
	::*The slope of different dilutions (if you made any) should be the same.		::*The slope of different dilutions (if you made any) should be the same.
	3. Define the ΔCt for target and reference populations (the Pfaffl paper uses "CP" instead of Ct).		3. Define the ΔCt for target and reference populations (the Pfaffl paper uses "CP" instead of Ct).

Michael A. Speer: /* Analysis */

2011-10-13T13:42:08Z

Analysis

Michael A. Speer: /* Analysis */

2011-10-13T13:37:40Z

Analysis

←Older revision		Revision as of 13:37, 13 October 2011
Line 67:		Line 67:
	*Comparative analysis of qPCR data is usually based on C<sub>T</sub> (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).		*Comparative analysis of qPCR data is usually based on C<sub>T</sub> (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).
	*The threshold for C<sub>T</sub> can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.		*The threshold for C<sub>T</sub> can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.
-	*In general, the ratio between two C<sub>T</sub>'s in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration. So the analysis methods are used primarily to compare two different C<~~sup~~>T</~~sup~~>'s between different samples, or to compare many samples to one reference sample. This provides much more in the way of interesting data. An example would be thus In sample A, the C<sub>T</sub> of population 1 is 2.5 higher than the C<sub>T</sub> of population 2, but in the control sample the C<sub>T</sub>'s are nearly equal. The 2<sup>-ΔΔC<sub>T</sub></sup> method allows us to more precisely quantify this change.	+	*In general, the ratio between two C<sub>T</sub>'s in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration. So the analysis methods are used primarily to compare two different C<sub>T</sub>'s between different samples, or to compare many samples to one reference sample. This provides much more in the way of interesting data. An example would be thus In sample A, the C<sub>T</sub> of population 1 is 2.5 higher than the C<sub>T</sub> of population 2, but in the control sample the C<sub>T</sub>'s are nearly equal. The 2<sup>-ΔΔC<sub>T</sub></sup> method allows us to more precisely quantify this change.

	===As Percentage of Total DNA===		===As Percentage of Total DNA===

Michael A. Speer: /* Primers */

2011-10-13T13:35:12Z

Primers

←Older revision		Revision as of 13:35, 13 October 2011
Line 14:		Line 14:

	==Primers==		==Primers==
-	To design primers you should probably use a computer program. With the programs suggestions it is important to run a ~~nBLAST~~ to check for non specific binding. It is also important to make sure that their products are the same length if you're going to be comparing different populations using SYBR green. For considerations on how to choose which primers to use, see the analysis section. We use the following primers on a regular basis to identify specific populations:	+	To design primers you should probably use a computer program. With the programs suggestions it is important to run a [http://www.ncbi.nlm.nih.gov/tools/primer-blast/ primer BLAST] to check for non-specific binding. It is also important to make sure that their products are the same length if you're going to be comparing different populations using SYBR green. For considerations on how to choose which primers to use, see the analysis section. We use the following primers on a regular basis to identify specific populations:
	*'''Quantification of total bacteria:'''		*'''Quantification of total bacteria:'''
	**Ftot - GCAGGCCTAACACATGCAAGTC		**Ftot - GCAGGCCTAACACATGCAAGTC

Michael A. Speer: /* Introduction */

2011-10-13T13:32:23Z

Introduction

←Older revision		Revision as of 13:32, 13 October 2011
Line 3:		Line 3:

	==Introduction==		==Introduction==
-	Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample. This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well. RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels. For more information on qPCR and its uses, please see the [[Real-time PCR\|qPCR hub page]] or the [[PCR techniques\|PCR hub page]]. ==Equipment==	+	Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample. This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well. RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels. For more information on qPCR and its uses, please see the [[Real-time PCR\|qPCR hub page]] or the [[PCR techniques\|PCR hub page]].
		+	==Equipment==
	*The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use. To access these systems you will need to [http://www.huck.psu.edu/facilities/genomics-core-up\|log in], and sign up on their calendar "CoreCal".		*The Genomics Core Facility at Penn State has two Applied Biosystems 7300 Real-Time PCR Systems that you can use. To access these systems you will need to [http://www.huck.psu.edu/facilities/genomics-core-up\|log in], and sign up on their calendar "CoreCal".
	*To run your sample you'll need a 96 well optical plate with a half skirt (AB part #N801-0560) and an optical film to cover it. You can purchase these directly from the core facility.		*To run your sample you'll need a 96 well optical plate with a half skirt (AB part #N801-0560) and an optical film to cover it. You can purchase these directly from the core facility.

Michael A. Speer: /* Running the sample */

2011-10-11T04:16:24Z

Running the sample

←Older revision		Revision as of 04:16, 11 October 2011
Line 50:		Line 50:
	:6. Start up the machine.		:6. Start up the machine.
	:7. Set up the following program.		:7. Set up the following program.
-	::*Detector = SYBR, Rox = NO	+	::*Detector = SYBR, Rox = Yes (but only if you added it)
	::*95°C for 10 min		::*95°C for 10 min
	::**95°C for 20sec		::**95°C for 20sec

Michael A. Speer: /* Notes */

2011-10-11T04:16:04Z

Notes

←Older revision		Revision as of 04:16, 11 October 2011
Line 36:		Line 36:
	:*3μL SYBR Green II (100x)		:*3μL SYBR Green II (100x)
	====Notes====		====Notes====
-	*ROX is supplied in a 25μM stock solution. The 40μL listed above is the amount used for Applied Biosystems ~~models~~ 7000, 7300, 7700, 7900HT, StepOne, and PRISM models. If using an AB 7500 only use 1/10 the amount of ROX suggested here.	+	*ROX is supplied in a 25μM stock solution. The 40μL listed above is the amount used for Applied Biosystems 7000, 7300, 7700, 7900HT, StepOne, and PRISM models. If using an AB 7500 only use 1/10 the amount of ROX suggested here.
	*If not using ROX (or using less ROX) substitute the remaining volume with water.		*If not using ROX (or using less ROX) substitute the remaining volume with water.

←Older revision		Revision as of 13:42, 13 October 2011
Line 67:		Line 67:
	*Comparative analysis of qPCR data is usually based on C<sub>T</sub> (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).		*Comparative analysis of qPCR data is usually based on C<sub>T</sub> (the cycle at which a given sample reaches some threshhold value of DNA fluorescence).
	*The threshold for C<sub>T</sub> can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.		*The threshold for C<sub>T</sub> can be manually set by the user, but is typically close to the point when the sample fluroescence elevates above background levels.
-	*In general, the ratio between two C<sub>T</sub>'s in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration. So the analysis methods are used primarily to compare two different C<sub>T</sub>'s between different samples, or to compare many samples to one reference sample. This provides much more in the way of interesting data. An example would be thus In sample A, the C<sub>T</sub> of population 1 is 2.5 higher than the C<sub>T</sub> of population 2, but in the control sample the C<sub>T</sub>'s are nearly equal. The 2<sup>-ΔΔC<sub>T</sub></sup> method allows us to more precisely quantify this change.	+	*In general, the ratio between two C<sub>T</sub>'s in one sample is not very interesting, and provides very little "real" information unless it's based on some kind of calibration. So the analysis methods are used primarily to compare two different C<sub>T</sub>'s between different samples, or to compare many samples to one reference sample. This provides much more in the way of interesting data. An example would be thus: "In sample A, the C<sub>T</sub> of population 1 is 2.5 higher than the C<sub>T</sub> of population 2, but in the control sample the C<sub>T</sub>'s are nearly equal." The 2<sup>-ΔΔC<sub>T</sub></sup> method allows us to more precisely quantify this change.

	===As Percentage of Total DNA===		===As Percentage of Total DNA===
Line 90:		Line 90:

	===Using the Pfaffl Method===		===Using the Pfaffl Method===
-	*This method corrects for differences in PCR efficiency as well as amplicon length.	+	*This is the prefered method as it corrects for differences in PCR efficiency as well as amplicon length without calibration.
-	*~~Should~~ probably run a dilution just to see if your values jive.	+	*You should probably run a dilution just to see if your values jive.
	*This method could be used to measure differential gene expression as well as comparative populations.		*This method could be used to measure differential gene expression as well as comparative populations.
	1. Definitions:		1. Definitions:
Line 97:		Line 97:
	::*Reference - The population you're comparing it to		::*Reference - The population you're comparing it to
	::*Control - A treatment for which you are measuring both target and reference populations		::*Control - A treatment for which you are measuring both target and reference populations
-	::*Sample - A treatment you are ~~comparing to the control treatment and~~ measuring both target and reference populations	+	::*Sample - A treatment for which you are measuring both target and reference populations comparing to the control treatment
	2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:		2. Define an efficiency for each reaction using the slope during the exponential phase of the reaction:
	::*Efficiency = E = 10<sup>-1/slope</sup>.		::*Efficiency = E = 10<sup>-1/slope</sup>.