Richard Lab:qPCR
From OpenWetWare
Back to PCR protocols
Back to Protocols
Contents |
Introduction
Quantitative PCR (qPCR or also called Real-time PCR) is a very useful protocol for determining comparitive populations in a sample. This protocol is primarily for comparing bacterial populations in environmental samples (like silage), but can be used for other purposes as well. RT-qPCR can also be used to quantify and compare RNA in a sample including comparing relative mRNA levels. For more information on qPCR and its uses, please see the qPCR hub page or the PCR hub page.
DNA Preparation
- Your DNA can be extracted from any sample. We commonly use a kit for this purpose, but there are a variety of methods around to extract DNA from many materials.
- An important consideration is that the DNA is free of humic acids, which are common contaminants of dna extracted from soil or silage samples. Humic acids will screw up your qPCR.
- Typically 1-20ng of DNA will be added to each (20μL) reaction. This will generally involve diluting your DNA.
Primers
To design primers you should probably use a computer program. It is also important to make sure that their products are the same legnth if you're going to be comparing different populations. We use the following primers on a regular basis to identify specific populations:
- Quantification of total bacteria:
- Ftot - GCAGGCCTAACACATGCAAGTC
- Rtot - CTGCTGCCTCCCGTAGGAGT
- Quantification of Lactobacillus spp.
- Flac - GCAGCAGTAGGGAATCTTCCA
- Rlac - GCATTYCACCGCTACACATG
- Quantification of Ferulic acid esterase gene from Lactobacillus jonhsonii
- Ffae - TTAAAACAGATCCGCATGTACGTAA
- Rfae - AGCCCAGCTAACATTGAAGCA
PCR Mix
While there are many commercial 2X PCR mixes to choose from, a cheap and easy homemade stock is really useful for most applications.
2X SYBR Mix
This recipe is to make 1ml of 2X qPCR master mix using Taq DNA polymerase (with thermopol buffer) available from New England Biolabs. This mix is enough to make an entire 96 well plate of 20μL qPCR reactions. After this mix is prepared it should be kept on ice until use.
- 730μL Water
- 200μL Thermopol Buffer (with Mg2+)
- 50μL dNTPs
- 10μL Taq DNA Polymerase (~15 units)
- 7μL each primer (100μM)
- 3μL SYBR Green II (100x)
Taqman Mix
You can also make a similar mix using a taqman probe instead of SYBR green. While the probes are expensive (over $100 each), they can lead to more reliable results, and eliminate the need for normalization based on the amplification product length when doing comparisons.
Running the sample
- Keep the master mix and your sample apart until immediately before running.
- After diluting your sample to contain 0.1-2ng/μL place 10μL of the diluted samples in each well in the plate.
- Immediately before running, add 10μL of 2X mix to each well (using a multi pipettor for this makes it much easier).
- Run the following program:
- 95°C for 10 min
- 95°C for 20sec
- 60°C for 60 sec
- Repeat the two-step cycle 45x
- 95°C for 10 min
- If you want to, you can do a melt curve to be sure that your primers are only amplifying one thing.
- Ramp from 50.0°C to 95.0°C
- Read every 0.2°C h
- Hold 00:00:02 between reads
- Ramp from 50.0°C to 95.0°C


