Rm2, RASSL based on hmc4-Receptor

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (17:47, 26 June 2009) (view source)
 
Line 21: Line 21:
acccaagctggctagttaagcttggtaccgagctcggatccactagtccagtgtggtggaattgccct
acccaagctggctagttaagcttggtaccgagctcggatccactagtccagtgtggtggaattgccct
tatcaattcagggggacactggaattcgcccttgcctatctagaataaacgctcaactttggcagatc
tatcaattcagggggacactggaattcgcccttgcctatctagaataaacgctcaactttggcagatc
-
cacc<font color="blue"ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATC
+
cacc<font color="blue">ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATC
-
TACTCTTGTGCCAGGGTGTGGTCTCC</font><font color="red"GATTACAAAGATGATGATGATGTC</font>GACTCCCCGATCCAGATC
+
TACTCTTGTGCCAGGGTGTGGTCTCC</font><font color="red">GATTACAAAGATGATGATGATGTC</font>GACTCCCCGATCCAGATC
TTCCGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGA
TTCCGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGA
CGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGC
CGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGC

Current revision

Rm2

This is the RASSL Melanocortin No. 1. The sequence is identical to hMC4R except for the D122A substitution that renders it a Gs-coupled RASSL. Rm1 has a higher basal activity than the wild-type receptor by ~ 50%.


gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatag ttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagc tacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgc ttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaatt acggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcc tggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa tagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaa gtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgc ccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattacca tggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagt ctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcg taacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagag ctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactatagggag acccaagctggctagttaagcttggtaccgagctcggatccactagtccagtgtggtggaattgccct tatcaattcagggggacactggaattcgcccttgcctatctagaataaacgctcaactttggcagatc caccATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATC TACTCTTGTGCCAGGGTGTGGTCTCCGATTACAAAGATGATGATGATGTCGACTCCCCGATCCAGATC TTCCGCGGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGA CGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGC TGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTG ACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGC CATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCG CCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGA CAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGC TCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTAC CTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTT CGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACCGGATCCTGAACTCCACCCACCGTG GGATGCACACTTCTCTGCACCTCTGGAACCGCAGCAGTTACAGACTGCACAGCAATGCCAGTGAGTCC CTTGGAAAAGGCTACTCTGATGGAGGGTGCTACGAGCAACTTTTTGTCTCTCCTGAGGTGTTTGTGAC TCTGGGTGTCATCAGCTTGTTGGAGAATATCTTAGTGATTGTGGCAATAGCCAAGAACAAGAATCTGC ATTCACCCATGTACTTTTTCATCTGCAGCTTGGCTGTGGCTGATATGCTGGTGAGCGTTTCAAATGGA TCAGAAACCATTATCATCACCCCATTAAACAGTACAGATACGGATGCACAGAGTTTCACAGTGAATAT TGCTAATGTCATTGACTCGGTGATCTGTAGCTCCTTGCTTGCATCCATTTGCAGCCTGCTTTCAATTG CAGTGGACAGGTACTTTACTATCTTCTATGCTCTCCAGTACCATAACATTATGACAGTTAAGCGGGTT GGGATCAGCATAAGTTGTATCTGGGCAGCTTGCACGGTTTCAGGCATTTTGTTCATCATTTACTCAGA TAGTAGTGCTGTCATCATCTGCCTCATCACCATGTTCTTCACCATGCTGGCTCTCATGGCTTCTCTCT ATGTCCACATGTTCCTGATGGCCAGGCTTCACATTAAGAGGATTGCTGTCCTCCCCGGCACTGGTGCC ATCCGCCAAGGTGCCAATATGAAGGGAGCGATTACCTTGACCATCCTGATTGGCGTCTTTGTTGTCTG CTGGGCCCCATTCTTCCTCCACTTAATATTCTACATCTCTTGTCCTCAGAATCCATATTGTGTGTGCT TCATGTCTCACTTTAACTTGTATCTCATACTGATCATGTGTAATTCAATCATCGATCCTCTGATTTAT GCACTCCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGAGGCCT TTGTGACTTGTCTAGCAGATATTAAatggggacagagcacgcaatataggaacaaagggcaattctgc agatatccagcacagtggcggccgctcgagtctagagggcccgcggttcgaaggtaagcctatcccta accctctcctcggtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgc tgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttcctt gaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctga gtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaat agcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctag ggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtga ccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttc gccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggca cctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggttt ttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactc aaccctatctcggtctattcttttgatttataagggattttggggatttcggcctattggttaaaaaa tgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaa gtccccaggctccccaggcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgt ggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccat agtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatg gctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtag tgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtatatccattttcgg atctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctc cggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgcc gccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccct gaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctg tgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctc ctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatac gcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcgga tggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactg ttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgctt gccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcgg accgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgac cgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttga cgagttcttctgagcgggactctggggttcgcgaaatgaccgaccaagcgacgcccaacctgccatca cgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccgg ctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaacttgtttattgcag cttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcat tctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagcta gagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacaca acatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaatt gcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcca acgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgct cggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatca ggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgc gttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcaga ggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctct cctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttc tcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacg aaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaaga cacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgc tacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctc tgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggt agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatccttt gatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagat tatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtata tatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct atttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccat ctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaac cagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaa ttgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgcta caggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaagg cgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcag aagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgc catccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcgg cgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagt gctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtga gcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcat actcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttg aatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtc

Personal tools