SBB09Ntbk-DaviddeRenzy: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 34: Line 34:
*Both expected products were present
*Both expected products were present
**M10041 had a small fragment (~1000bp) of unknown DNA
**M10041 had a small fragment (~1000bp) of unknown DNA
 
[[Image:DSD_Analytical_gel_2-23-09.jpg]]
*Performed Zymo clean-up on M10040 & M10041
*Performed Zymo clean-up on M10040 & M10041
**Eluted final products into 33μL water
**Eluted final products into 33μL water

Revision as of 13:40, 23 February 2009

David De Renzy 14:34, 4 February 2009 (EST)

Edit personal page
Make wiki notebook


David De Renzy 14:53, 18 February 2009 (EST)

  • Reconstituted oligos to 100μM
  • Ran basic PCR cloning reaction
  • PCR Odd001F/Odd002R on E. Coli plasmid pAPEC-1 (AF218073) (1603 bp, EcoRI/BamHI
  • Into PCR tube labeled M10040
    • Odd001F Forward EcoRI oligo for TshA ccataGAATTCatgAGATCTacacttttacctgtatacg
    • Odd002R Reverse BamHI oligo for TshA ctgatGGATCCtcagaatgaataacgaatattagcg

AND

  • PCR Odd003F/BBa_G00101 on pBca1256-Bca1346 (3722 bp, EcoRI/BamHI)
  • Into PCR tube labeled M10041
    • Odd003F Forward oligo for INP ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
    • BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc

 
 Next step -> Run Analytical Gel

David De Renzy 15:38, 23 February 2009 (EST)

  • Ran Analytical gel on M10040 & M10041
    • 5μL PCR product + 5μL blue loading buffer (concentration was weak)
  • Both expected products were present
    • M10041 had a small fragment (~1000bp) of unknown DNA

  • Performed Zymo clean-up on M10040 & M10041
    • Eluted final products into 33μL water

Digest and gel purify M10040 & M10041
Maybe, run another analytical gel & purify with remaining "zymo-cleaned" M10041
OR
Run a more stringent PCR for M10041 with higher annealing temperatures