SBB09Ntbk-DaviddeRenzy

David De Renzy 14:34, 4 February 2009 (EST)

Edit personal page
Make wiki notebook

David De Renzy 14:53, 18 February 2009 (EST)

• Reconstituted oligos to 100μM
• Ran basic PCR cloning reaction
• PCR Odd001F/Odd002R on E. Coli plasmid pAPEC-1 (AF218073) (1603 bp, EcoRI/BamHI
• Into PCR tube labeled M10040
  
  • Odd001F Forward EcoRI oligo for TshA ccataGAATTCatgAGATCTacacttttacctgtatacg
  • Odd002R Reverse BamHI oligo for TshA ctgatGGATCCtcagaatgaataacgaatattagcg

AND

• PCR Odd003F/BBa_G00101 on pBca1256-Bca1346 (3722 bp, EcoRI/BamHI)
• Into PCR tube labeled M10041
  • Odd003F Forward oligo for INP ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
  • BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc

 
 Next step -> Run Analytical Gel

David De Renzy 15:38, 23 February 2009 (EST)

• Ran Analytical gel on M10040 & M10041
  • 5μL PCR product + 5μL blue loading buffer (concentration was weak)
• Both expected products were present
  • M10041 had a small fragment (~1000bp) of unknown DNA

• Performed Zymo clean-up on M10040 & M10041
  • Eluted final products into 33μL water

Digest and gel purify M10040 & M10041
Maybe, run another analytical gel & purify with remaining "zymo-cleaned" M10041
OR
Run a more stringent PCR for M10041 with higher annealing temperatures

David De Renzy 14:21, 25 February 2009 (EST)

• Digested M10040 & M10041
  • Used 8μL of each PCR product for digest
• Gel purified M10040 & M10041 Digests
• Also gel purified 15μL of M10040 PCR product (after zymo clean-up)

Ligation
Transformation

David De Renzy 14:58, 27 February 2009 (EST)

• Performed ligation of EcoRI/BamHI digests for pBca9495KC-M10040 & pBca9495CA-M10041
• Transformed ligation products into E. coli cells
  • Plated pBca9495CA-M10041 transformed cells onto a CA (ampicillin) selective plate
  • Plated pBca9495KC-M10040 transformed cells onto a KC (Kanamycin) selective plate

Next-Pick colonies

David De Renzy 14:14, 2 March 2009 (EST)

• NO COLONIES FOUND!
• Sources of Error:
  • No gel purification was performed after digestion
  • For pBca9495CA vector, proper extended incubation period at 37°C for 40 mins was not performed
• Started back at digestion step
  • Used M10040 Product after Zymo cleanup
  • Used M10041 product after Zymo cleanup and gel purification (to remove 1kb unwanted fragment
• Gel purification
  • column1=M10040, column2=M10041, column3=Ladder
  • Cut out gels were each place in 600μL of ADB buffer in labeled eppendorf tubes

Next-> finish gel purification
Maybe start ligation/transformation

David De Renzy 14:24, 4 March 2009 (EST)

• Zymo gel purification of M10040 & M10041 completed
  • eluted into 8.5μL of ddH20 for each
  • Performed ligation of EcoRI/BamHI digests for pBca9495KC-M10040 & pBca9495CA-M10041
• Transformed ligation products into E. coli cells
  • Performed 40 min shake & incubation at 37°C with 100μL LB added for both products
  • Plated pBca9495CA-M10041 transformed cells onto a CA (ampicillin) selective plate
  • Plated pBca9495KC-M10040 transformed cells onto a KC (Kanamycin) selective plate
• Note: Amp=Red, K=green, C=blue

Next-pick colonies