SBB09 Oligos: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 13: | Line 13: | ||
<pre> | <pre> | ||
Bso001 Cloning of Autotransporter ccataGAATTCatgAGATCTggctggcaggtcgtcaag | |||
Bso002 Cloning of Autotransporter GCTAGggatccTCAatcagctttaccctccac | |||
Bso003 Cloning of PL2_Passenger_AT to Autotransporter ccataGAATTCatgAGATCTtgccggcggcgaccagactgtac | |||
Bso004 Cloning of PL2_Passenger_AT to Autotransporter gctagGGATCCatcagctttaccctccac | |||
</pre> | </pre> | ||
Revision as of 12:56, 6 February 2009
Put your oligo sequences into this page. Separate each column with tabs:
ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
Ost001F Forward oligo for upaG ccaaaGAATTCatgAGATCTgttgagatggataacaaactg Ost002R Reverse oligo for upaG ctagcGGATCCttaCCACtgaataccggcaccgag Ost003F Forward construction for HydroxyapatiteBP ccaaaGAATTCatgAGATCTgcgccgtggcatctgagcagccagtatag Ost004R Reverse construction for HydroxyapatiteBP ctagcGGATCCggtgcggctatactggctgctcagatgc
Bso001 Cloning of Autotransporter ccataGAATTCatgAGATCTggctggcaggtcgtcaag Bso002 Cloning of Autotransporter GCTAGggatccTCAatcagctttaccctccac Bso003 Cloning of PL2_Passenger_AT to Autotransporter ccataGAATTCatgAGATCTtgccggcggcgaccagactgtac Bso004 Cloning of PL2_Passenger_AT to Autotransporter gctagGGATCCatcagctttaccctccac
