SBB09 Oligos: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 47: Line 47:


<pre>
<pre>
Bdd001F Forward EcoRI oligo for Tsh Autotransporter ccataGAATTCatgAGATCTacacttttacctgtatacg
Odd001F Forward EcoRI oligo for Tsh Autotransporter ccataGAATTCatgAGATCTacacttttacctgtatacg
Bdd002R Reverse BamHI oligo for Tsh Autotransporter ctgatGGATCCtcagaatgaataacgaatattagcg
Odd002R Reverse BamHI oligo for Tsh Autotransporter ctgatGGATCCtcagaatgaataacgaatattagcg
Bdd003F Forword oligo for Ice Nucleation Protein ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
Odd003F Forward oligo for Ice Nucleation Protein ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
BBa_G00101 Reverse sequencing of pSB1A* plasmids (for INP) attaccgcctttgagtgagc
BBa_G00101 Reverse sequencing of pSB1A* plasmids (for INP) attaccgcctttgagtgagc
</pre>
</pre>

Revision as of 12:26, 9 February 2009

Put your oligo sequences into this page. Separate each column with tabs:

ca998	Forward Sequencing of pSB1A2/pSB1A3	gtatcacgaggcagaatttcag
G00101	Reverse sequencing of pSB1A* plasmids	attaccgcctttgagtgagc
Ost001F	Forward oligo for upaG	ccaaaGAATTCatgAGATCTgttgagatggataacaaactg
Ost002R	Reverse oligo for upaG	ctagcGGATCCttaCCACtgaataccggcaccgag
Ost003F	Forward construction for HydroxyapatiteBP	ccaaaGAATTCatgAGATCTgcgccgtggcatctgagcagccagtatag
Ost004R	Reverse construction for HydroxyapatiteBP	ctagcGGATCCggtgcggctatactggctgctcagatgc
Oso001 Cloning of Autotransporter  ccataGAATTCatgAGATCTggctggcaggtcgtcaag
Oso002 Cloning of Autotransporter  GCTAGggatccTCAatcagctttaccctccac
Oso003 Cloning of PL2_Passenger_AT to Autotransporter  ccataGAATTCatgAGATCTtgccggcggcgaccagactgtac
Oso004 Cloning of PL2_Passenger_AT to Autotransporter  gctagGGATCCatcagctttaccctccac
Ojb001F        Forward construction of CPG_L2 N term part         ctctgGAATTCatgAGATCTgaggaaaggaacgactgg
Ojb001R        Reverse construction of CPG_L2 N term part          catgtGGATCCttacgcgctataatctaccggcc
Ojb002F        Forward construction of CPG_L2 C term part         ctctgGAATTCatgAGATCTggtaaacgtggaacgtggtt
Ojb003F        Forward removal of XhoI site in CPG_L2                  actattatctTgagcgcggc
Ojb003R        Reverse removal of XhoI site in CPG_L2                  gccgcgctcAagataatagt
Ojb002R        Reverse construction of CPG_L2 C term part          catgtGGATCCgaacgagtaatttacgccga
Ojb004F        Forward SOEing oligo for CPG_L2                        GGATCTAAGTCTCGTCGCgaggaaaggaacgactggca
Ojb004R        Reverse SOEing oligo for CPG_L2                        GCGACGAGACTTAGATCCgaacgagtaatttacgccga
Ojb005F        Forward construction of CPG_L6 N term part          ctctgGAATTCatgAGATCTgaggaaaggaacgactgg
Ojb005R        Reverse construction of CPG_L6 N term part     catgtGGATCCttactgccagtcccagttactcc
Ojb006F        Forward construction of CPG_L2 C term part        ctctgGAATTCatgAGATCTgatgatattgaacgtgaagg
Ojb006R        Reverse construction of CPG_L2 C term part       catgtGGATCCgaacgagtaatttacgccga
Bhs001F  Forward EcoRI for a~eaeA_Display>           cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from eaeA_Display   GTTAATCAGAAcTCATTTGCAAATG
Bhs002R  Removing the EcoRI site from eaeA_Display   CATTTGCAAATGAgTTCTGATTAAC
Bhs003R  Reverse BamHI for a~eaeA_Display>           GCAAAggatccGCCTTGGTTTGATCAA
Osn0001-F  Forward Bglbricking of espP of Escherichia coli O157:H7 str. Sakai    ccagtGAATTCatgAGATCTgccccgtcagcatctgccac
Osn0002-R  Reverse Bglbricking of espP of Escherichia coli O157:H7 str. Sakai    gcagtGGATCCtcagaacgagtaacggaaattag
Odd001F	Forward EcoRI oligo for Tsh Autotransporter	ccataGAATTCatgAGATCTacacttttacctgtatacg
Odd002R	Reverse BamHI oligo for Tsh Autotransporter	ctgatGGATCCtcagaatgaataacgaatattagcg
Odd003F	Forward oligo for Ice Nucleation Protein	ccaaaGAATTCatgAGATCTtgtaATGaatctcgacaaggcg
BBa_G00101 	Reverse sequencing of pSB1A* plasmids (for INP)	attaccgcctttgagtgagc