SBB10AssayTeam4-Notes

Carolyn Kwok, Jing Luo, Dorothy Tulanont

Goals

1. Determine whether the N15 protelomerase parts are functional or not on the Tos site assuming the co-transformation is stable.
2a. If the plasmids don't stably co-transform, determine whether cells containing N15 protelomerase enrich for plasmids lacking tos.
2b. Assuming the N15 protelomerase parts are functional, determine whether the linearized "doggy bone" re-circularized in the absence of N15 protelomerase.

General Procedure

Part 1
Experiment:
1. Cotransform cells with plasmid containing the tos site and N15 protelomerase expressing plasmid.
2. Heat-shock
3. Plate with resistance plate
4. Miniprep cells
5. Digest the resulting plasmid with a restriction enzyme.
6. Analytical Mapping
Controls:
1. Transform the cells with only the Tos site plasmid
2. Run the undigested cotransformed DNA.

Part 2a
Experiment:
1. Transform cells with N15 plasmids
2. Plate on antibiotic for N15
3. Pick colonies
4. Mix Tos plasmid and RFP plasmid at a 100:1 ratio
5. Transform mixture into cells
6. Plate on antibiotics for Tos, RFP, and N15 (plate 1)
7. Count ratio of white colonies to red colonies
Control:
1. Mix Tos plasmid and RFP plasmid at a 100:1 ration, transform into cells without N15 and plate (plate 2)
Calculation:
Enrichment = % of red in plate 1/% of red in plate 2

Part 2b
1. Prepare "doggy bone" plasmid and the non-linearized plasmid.
2. Transform "doggy bone" plasmid and the non-linearized plasmid into cells with N15 and cells without N15 (the wild type cells).
3. Count colonies on all 4 plates.

4/12/10

Oligos to fix the point deletion in the tos plasmid using quikchange:

Forward oligo: CAATATGTATCTATTCCGGTGTTGTGTTCCTTTGTTATTCTGC
Reverse oligo: GCAGAATAACAAAGGAACACAACACCGGAATAGATACATATTG

The oligos were diluted to 100uM. Then a quikchange procedure was performed on the tos plasmid according to the Stratagene manual. The following sample reaction was prepared:

 
5 μl of 10× reaction buffer 
2 μl plasmid 
1.25 μl forward oligo
1.25 μl reverse oligo
1 μl of dNTP mix
39.5 μl ddH2O
1 ul PfuTurbo DNA Polymerase

The sample reaction was placed in the thermocycler with the following conditions:

Segment     Cycles      Temperature        Time
1              1           95°C          30seconds
2              12          95°C          30 seconds
                           55°C          1 minute
                           68°C          3 minute (1 min/kb of plasmid length)

4/14/10

Dpn I Digestion of the Tos Amplification Products:

1. 1 μl Dpn I was added to the product and mixed.
2. The reaction was incubated at 37°C for 1 hour.

The tos quikchange products were then transformed into DH10B cells and plated on Amp plates.
The following protocol was used for transformation:
Transformation by Heat Shock
Note No rescue was performed for the transformation mixture because the tos plasmid has Amp resistance.

4/15/10

No quikchange tos plasmid colonies grew.

4/19/10

Notes from last experiment: Our bacteria failed to grow. We have to change the Quikchange protocol.
Dorothy: Digest the vector with pBad and N15 plasmid with BglII and XbaI. Next time --> gel purification of these parts and we can proceed on to ligation.

Digestion of vector (pWCD 0011)
3 uL of water
1 uL NEB2+ATP buffer
5 uL of vector
0.5uL of  BglII
0.5uL of XbaI

Digestion of insert (N15) 
3 uL of water
1 uL of NEB2+ATP buffer
5 uL of insert
0.5uL of  BglII
0.5uL of XbaI

Jing: Finished the digestion by running a preparative gel to extract the necessary fragments to ligate. After double checking the sequences, discovered that the restriction enzymes we used cut the vector into three fragments. (There was a different plasmid that would work, and had a very similar name to the one we used, which was why we were told to use the wrong one.)

Also the gel showed that: 1. The restriction digest wasn't very effective. There was about 50% of the parent plasmid leftover. 2. The digestion products were very close to each other. There was no way to accurately pull out the desired fragment. Thus we scrapped it, and planned to start over later.
The oligos that were placed into the ice bucket are lost. Dorothy will come into the lab to start the PCR for quikchange on Tu 4/20 around 6PM.

4/20/10

Dorothy finished the quikchange pcr successfully using the following protocol: QuickChange

4/21/10

Tos part: Digestion, Transformation, and Plating of Tos:

25uL of the tos quikchange product was digested with 0.5 uL of Dpn I and then incubated for 1 hr at 37C. 
The other 25uL of the tos quikchange product was not digested as a control. 

The digested product was then transformed into DH10B cells. 
70uL of cell+KCM+H20 mixture was added to both the digested quikchange product and the control. 
(Note: The rescue part of the transformation procedure was not performed because the tos plasmid has Amp resistance)

Because more DNA was added, (only 10uL should have been used), the product was then plated unevenly on Amp plates. 

N15 part: We redigested the N15 plasmid and vector with new restriction enzymes. Then ran a preparative gel was run for the N15 vector and insert.

1. ladder
2. N15 Vector
3. N15 Insert
4. ladder

The bands corresponding for each were cut out and gel purified using the following procedure: Zymo Gel Purification

4/22/10

Tos part:
Dorothy picked three tos colonies and cultured them.

4/23/10

Tos part:
Carolyn miniprepped the three tos bacteria. Dorothy and Jing ran an analytical gel of tos. We sent the first clone to sequence for verification that the incorrect nucleotide has changed.

4/26/10

N15 part:
Ligated the vector and insert, then transformed the cells with N15 plasmid and plated on Kan/Spec.

4/27/10

No colonies on Kan/Spec plate from cells transformed with N15 plasmid. 2nd attempt at tos plasmid, re-picked smaller colonies from QuickChange plate for sequencing. Chris believed the tos part might be toxic to the cell thus the cell with the correct sequence will grow slower. This is the rationale behind picking the smaller colonies.

4/28/10

Tos part:
Tubes are clear thus assuming no growth from smaller colonies.

Results/Discussion

Tos plasmid result: