SBB11Ntbk-NikitPatel: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Nikit Patel (talk | contribs) |
Nikit Patel (talk | contribs) No edit summary |
||
Line 39: | Line 39: | ||
==[[User:Nikit Patel|Nikit Patel]] 12:35, 17 February 2011 (EST)== | ==[[User:Nikit Patel|Nikit Patel]] 12:35, 17 February 2011 (EST)== | ||
* P_sbp Products A and B | * P_sbp Products A and B | ||
:- Ran | :- Ran preparative gel | ||
:- Lanes 2 and 3 from gel confirmed sizes around 250 and 500 bp respectively | :- Lanes 2 and 3 from gel (below) confirmed sizes around 250 and 500 bp respectively | ||
:- Bands were cut | :- Bands were cut | ||
:- Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymo Gel Purification] on both A + B | :- Performed [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymo Gel Purification] on both A + B | ||
:- Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler) | :- Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler) | ||
[[Image:021711-PrepGel1.jpg | 250 px]] | |||
* P_fadL Products | * P_fadL Products | ||
:- Ran | :- Ran analytical gel (prepped 2uL DNA + 5uL Dye) | ||
:- Band in lane 2 from gel confirmed size around 600 bp | :- Band in lane 2 from gel (below) confirmed size around 600 bp | ||
:- Perform [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo1 Regular Zymo Cleanup] | :- Perform [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo1 Regular Zymo Cleanup] | ||
[[Image:021711-AnalGel2.jpg | 250px]] | |||
==[[User:Nikit Patel|Nikit Patel]] 18:17, 18 February 2011 (EST)== | ==[[User:Nikit Patel|Nikit Patel]] 18:17, 18 February 2011 (EST)== |
Revision as of 02:08, 22 February 2011
Constructing Basic Parts
Nikit Patel 11:30, 15 February 2011 (EST)
- Create 100uM stock of oligos: P_sbp_inR and SS50r
- Followed Cloning by PCR Protocol:
- - Used construction files below to setup PCR
- - Did first part of SOEing for P_sbp basic part
- - Thermocycler Program: 2K55
Construction of P_sbp BglBrick basic part sbb1124 PCR ss50f/P_sbp_inR on MG1655 (247 bp, gp = A) PCR P_sbp_inF/ss50r on MG1655 (492 bp, gp = B) --------------------------------------------------- PCR ss50f/ss50r on A+B (710 bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144 (EcoRI/BamHI, 3131+910, L) Product is pBjh1601KC-sbb1124 {P_sbp} --------------------------------------------------- P_sbp_inR Reverse removal of EcoRI site in P_sbp CAATAAATTGCAGAAGTCATGTAGGCCTG P_sbp_inF Forward removal of EcoRI site in P_sbp CAGGCCTACATGACTTCTGCAATTTATTG ss50f sbp aaaccGAATTCatgAGATCTgcggtcgttgtgtaggtatccag ss50r sbp tttggGGATCCcaacatcagcttcaataccgttg
Part sbb1104 {P_fadL} PCR ss29f/ss29r on MG1655 gen. (611bp, EcoRI/BamHI) Sub into pBjh1601KC-Bca1144#5 (EcoRI/BamHI, 3131+910, L) Product is pBjh1601KC-sbb1104 {P_fadL} --------------------------------------------------- ss29fForward Cloning of P_fadL aaaccGAATTCatgAGATCTgctttttcagtcagcgccgccag ss29rReverse Cloning of P_fadL tttggGGATCCgataagtgccactgcgactgcgagagc
Nikit Patel 12:35, 17 February 2011 (EST)
- P_sbp Products A and B
- - Ran preparative gel
- - Lanes 2 and 3 from gel (below) confirmed sizes around 250 and 500 bp respectively
- - Bands were cut
- - Performed Zymo Gel Purification on both A + B
- - Setup and run PCR for SOEing using Zymo Gel Purified DNA as template. (Used 2K55 mode for thermocycler)
- P_fadL Products
- - Ran analytical gel (prepped 2uL DNA + 5uL Dye)
- - Band in lane 2 from gel (below) confirmed size around 600 bp
- - Perform Regular Zymo Cleanup
Nikit Patel 18:17, 18 February 2011 (EST)
- P_sbp SOEing PCR products
- - Ran analytical gel
- - Lane 2 from gel confirmed size around 750 bp. (SOEing worked!)
- - Performed Regular Zymo Cleanup