SBB11Ntbk-SuhaniVora

Suhani Vora 14:08, 15 February 2011 (EST)

Today we set up PCR reactions for our promoter parts.
-Resuspended oligos PmalK_R and SV_06 to 100 uM.
-Diluted primers to 10 uM.
-Set up PCR for cloning using Cloning by PCR Protocol
1. P_malk
2. P_nlpA
3. P_rfaQ
Thermocycler Program: 2K55

Construction Files:

PCR ss61f/P_malKR on E. coli MG1655 gDNA  (525 bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144               (EcoRI/BamHI, 3131+910 bp, L) 
Product is pBjh1601KC-sbb1134             {P_malK}
----------------------------------------------------------------
ss61f	BglBrick basic part cloning of lamB promoter	AAACCGAATTCATGAGATCTATGCGGATAATGCGAGGATGCGTGCACCTG
P_malkR	BglBrick basic part cloning of lamB promoter	CTGATggatccACCTTCATGGATATCGAGATTG

Part sbb1132                       {P_nlpA}
PCR ss58r/SV_06 on MG1655 gen.              (542bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5                 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1132                       {P_nlpA}
------------------------------------------------------
ss58r	Forward Cloning of P_nlpA                                 aaaccGAATTCatgAGATCTgcttcccaataattgctctg
SV_06	P_nlpAR  (reverse cloning of P_nlpA BglBricks basic part) CTGATGGATCCCCGTAGATGATGTGTTGTCAG

Part sbb1121                       {P_rfaQ}
PCR ss47r/ss47f on MG1655 gen.                (1031bp, EcoRI/BamHI)
Sub into pBjh1601KC-Bca1144#5                 (EcoRI/BamHI, 3131+910, L)
Product is pBjh1601KC-sbb1121                       {P_rfaQ}
------------------------------------------------------
ss47fReverse Cloning of P_rfaQ     tttggGGATCCttttcagacaaaatagggatggtgtcctg
ss47rForward Cloning of P_rfaQ     aaaccGAATTCatgAGATCTattttacgtttatgtagcgccgcaatcagg

Suhani Vora 13:24, 17 February 2011 (EST)

Ran PCR samples of P_malK, P_nlpA, P_rfaQ on analytical gel.

2ul Sample + 5 uL Loading Dye Buffer

Sample 1 [Lane 3]: P_malK (525 bp)
Sample 2 [Lane 4]: P_nlpA (542 bp)
Sample 3 [Lane 5]: P_rfaQ (1031 bp)

Cleaned with Zymo Cleanup : May have used wrong buffer.

All PCR products for the class were thrown out, re-done by Prof. Anderson.

Suhani Vora 13:37, 22 February 2011 (EST)

P_nlpA PCR failed yesterday. Will have to move on without that part.

EcoRI/BamHI Digest of P_rfaQ (sbb1121) and P_malK (sbb1134) using Using EcoRI/BamHI Digest Protocol

Place in thermocycler at 37 deg for 1 hr.

Gel E Lane 3: sbb1121 (P_rfaQ) [1031 bp]
Gel E Lane 4: sbb1134 (P_malK) [525 bp]

Shout out to Chris for hookin' us up with some sweet PCR.

(Gel cut out by Prof. Anderson, thanks!)

~~!~~

Zymo Gel Purification of sbb1121 and sbb1134 usingZymo Gel Purification Protocol

Eluted in 8ul DDW

Happy Birthday Vinidhra Mani!!!