SBB12Ntbk-Tina Nie

--Tina Nie 14:25, 16 February 2012 (EST))

First day of labwork: Set up two PCR reactions. Set up wobble reaction for sbb1227:

Wobble tn001F/tn002R            (64bp, wobpdt)
Digest wobpdt                   (NheI/BamHI, L, wobdig)
Digest pBca9525-Bca1834         (NheI/BamHI, L, vectdig)
Ligate wobdig and vectdig (pBca9525-sbb1227) {Leu8}
----------------------------------------------------------------------
>tn001F Forward construction of sbb1227 basic part
ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTG
>tn002R Reverse construction of sbb1227 basic part
CTGATggatccTTACAGGAGTAGCAGCAACAGTAGCAGaccag
>wobpdt
ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTGCTACTCCTGTAAggatccATCAG

Using protocol:

1. 29 uL water
2. 5 uL Expand 10x Buffer 2
3. 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
4. 5 uL Oligo 1 (100uM)
5. 5 uL Oligo 2 (100uM)
6. 0.75 uL Expand Polymerase 1

Set up PCA1 (assembly) reaction for sbb1213:

PCA1 on o15,o11,o12       (pca1)
PCA2 with o15/o12 on pca1 (139 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1213dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1213dig + vectdig, product is pBca9525-sbb1213
----
>o15	
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGT
>o11
CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA
>o12
CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG

Using protocol:

1. 38 uL ddH2O
2. 5 ul 10x expand buffer
3. 5 ul 2mM dNTPs
4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
5. 0.75 ul Expand polymerase

Both programs run for us after class.

Dilutions I made to make up 100uM solutions:

tn001F: 23.4nM + 234uL ddH2O

tn002R: 23.4nM + 234uL ddH2O

O15: 86.1nM + 861uL ddH2O

--Tina Nie 17:19, 17 February 2012 (EST)

Used Small Fragment Zymo Cleanup on both the wobble reaction product (for sbb1227) and the PCA1 product(for sbb1213), using the following protocol:

1. Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
2. Transfer into the Zymo column (small clear guys)
3. Add 500uL of Ethanol and pipette up and down to mix
4. spin through (15s), discard waste.
5. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
6. spin through (15s), discard waste.
7. Add 200 uL of Zymo Wash Buffer
8. spin through, discard waste.
9. spin for 90 seconds, full speed to dry.
10. elute with water (spin 60s) into a fresh Eppendorf tube

I used 50uL of ddH2O to elute.

After Small-frag Zymo I set up the PCA amplification reaction (PCA2), using the following protocol:

1. 1 ul each outer oligo (10 uM)
2. 1 ul purified pca product
3. .5 ul phusion
4. 10 ul 5x phusion buffer
5. 5 ul 2mM dNTPs
6. 32.5 ul H2O

The PCR program was run for us after class.