SBB12Ntbk-Tina Nie

--Tina Nie 14:25, 16 February 2012 (EST))

First day of labwork: Set up two PCR reactions. Set up wobble reaction for sbb1227:

Wobble tn001F/tn002R            (64bp, wobpdt)
Digest wobpdt                   (NheI/BamHI, L, wobdig)
Digest pBca9525-Bca1834         (NheI/BamHI, L, vectdig)
Ligate wobdig and vectdig (pBca9525-sbb1227) {Leu8}
----------------------------------------------------------------------
>tn001F Forward construction of sbb1227 basic part
ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTG
>tn002R Reverse construction of sbb1227 basic part
CTGATggatccTTACAGGAGTAGCAGCAACAGTAGCAGaccag
>wobpdt
ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTGCTACTCCTGTAAggatccATCAG

Using protocol:

1. 29 uL water
2. 5 uL Expand 10x Buffer 2
3. 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
4. 5 uL Oligo 1 (100uM)
5. 5 uL Oligo 2 (100uM)
6. 0.75 uL Expand Polymerase 1

Set up PCA1 (assembly) reaction for sbb1213:

PCA1 on o15,o11,o12       (pca1)
PCA2 with o15/o12 on pca1 (139 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1213dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1213dig + vectdig, product is pBca9525-sbb1213
----
>o15	
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGT
>o11
CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA
>o12
CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG

Using protocol:

1. 38 uL ddH2O
2. 5 ul 10x expand buffer
3. 5 ul 2mM dNTPs
4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
5. 0.75 ul Expand polymerase

Both programs run for us after class.

Dilutions I made to make up 100uM solutions:

tn001F: 23.4nM + 234uL ddH2O

tn002R: 23.4nM + 234uL ddH2O

O15: 86.1nM + 861uL ddH2O

--Tina Nie 17:19, 17 February 2012 (EST)

Used Small Fragment Zymo Cleanup on both the wobble reaction product (for sbb1227) and the PCA1 product(for sbb1213), using the following protocol:

1. Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
2. Transfer into the Zymo column (small clear guys)
3. Add 500uL of Ethanol and pipette up and down to mix
4. spin through (15s), discard waste.
5. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
6. spin through (15s), discard waste.
7. Add 200 uL of Zymo Wash Buffer
8. spin through, discard waste.
9. spin for 90 seconds, full speed to dry.
10. elute with water (spin 60s) into a fresh Eppendorf tube

I used 50uL of ddH2O to elute.

After Small-frag Zymo I set up the PCA amplification reaction (PCA2), using the following protocol:

1. 1 ul each outer oligo (10 uM)
2. 1 ul purified pca product
3. .5 ul phusion
4. 10 ul 5x phusion buffer
5. 5 ul 2mM dNTPs
6. 32.5 ul H2O

The PCR program was run for us after class.

--Tina Nie 13:25, 21 February 2012 (EST)

I used Small-frag Zymo to purify the PCA2 product, following the protocol:

1. Add 100 uL of Zymo ADB buffer (brown bottle) to the reaction.
2. Transfer into the Zymo column (small clear guys)
3. Add 500uL of Ethanol and pipette up and down to mix
4. spin through (15s), discard waste.
5. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
6. spin through (15s), discard waste.
7. Add 200 uL of Zymo Wash Buffer
8. spin through, discard waste.
9. spin for 90 seconds, full speed to dry.
10. elute with water (spin 60s) into a fresh Eppendorf tube

using 51uL of ddH2O to elute.

After the Zymo clean up I ran the product on an analytic gel to check I had the right product.

I used 6uL of the purified DNA and 4uL of loading dye in the gel.

In my column there was a very faint band at about 100 bases (by comparison with the DNA ladder). It may be consistent with the PCA2 product which should be 139bp but it is difficult to tell.

I set up the digestion reaction for sbb1227 (Leu8) using the following protocol:

50uL eluted DNA
5.7uL NEB Buffer 2
0.5uL NheI
0.5uL BamHI

I incubated this for 1 hour at 37 degrees.

I also set up the digestion for sbb1213 (lz_AAAA-2) using the following:

8uL of eluted PCR product
1uL of NEB Buffer 2
0.5uL NheI
0.5uL BamHI

and incubated at 37 degrees for 1 hour.

After the incubation time I added 100 uL of Zymo ADB buffer to each reaction (first step of small-frag Zymo clean-up) to kill the enzymes. I will finish the Zymo clean-up next lab class.

--Tina Nie 13:40, 23 February 2012 (EST)

I finished the small-frag Zymo cleanup for both parts following the protocol:

1. Transfer into the Zymo column (small clear guys)
2. Add 500uL of Ethanol and pipette up and down to mix
3. spin through (15s), discard waste.
4. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
5. spin through (15s), discard waste.
6. Add 200 uL of Zymo Wash Buffer
7. spin through, discard waste.
8. spin for 90 seconds, full speed to dry.
9. elute with water (spin 60s) into a fresh Eppendorf tube

I used 56.7uL of ddH2O to elute the sbb1227 digestion product, and 10uL of ddH2O to elute the sbb1213 digestion product.

I then set up both ligations using the following:

 6.5uL ddH2O
 1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
 1uL Vector digest (pBca9525-Bca1834 NdeI/BamHI, this was already digested for us)
 1uL Insert digest
 0.5uL T4 DNA Ligase

• Pound upside down on the bench to mix
• Give it a quick spin to send it back to the bottom of the tube
• Incubate on the benchtop for 30min
• Put on ice and proceed to the transformation

I used the follwoing protocol for the transformations:

  1. Thaw a 200 uL aliquot of cells on ice
  2. Add 50 uL of water to the cells (if greater volume is desired)
  3. Add 30 uL of KCM to the cells 
  4. Put your ligation mixture on ice, let cool a minute or two (for Miniprep product, dilute by 10, then use 1uL of dilution)
  5. Add 70 uL of the cell cocktail to the ligation, stir to mix
  6. Let sit on ice for 10 min
  7. Heat shock for 90 seconds at 42 (longer incubation may work better)
  8. Put back on ice for 1 min
  9. Add 100uL of 2YT, let shake in the 37 degree incubator for 1 hour
 10. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight

However there was less cells in each aliquot than the 200uL expect (it was more like 100 uL) so we added only 15uL of KCM and used 50uL of cells in each transformations.