SBB13Ntbk-Ted Chavkin

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 2: Line 2:
==[[User:Theodore A Chavkin|Theodore A Chavkin]] 10:08, 12 March 2013 (PST)==
==[[User:Theodore A Chavkin|Theodore A Chavkin]] 10:08, 12 March 2013 (PST)==
-
======Running Zymo Cleanup on PCA1======
+
Running Zymo Cleanup on PCA1:<br>
<pre>
<pre>
Regular Zymo Cleanup
Regular Zymo Cleanup
Line 18: Line 18:
</pre>
</pre>
-
======Running PCA2:======
+
Running PCA2:<br>
<pre>
<pre>
Recipe
Recipe
-
1 ul each outer oligo (10 uM)
+
*1 ul each outer oligo (10 uM)
-
1 ul purified pca product
+
*1 ul purified pca product
-
.5 ul phusion
+
*.5 ul phusion
-
10 ul 5x phusion buffer
+
*10 ul 5x phusion buffer
-
5 ul 2mM dNTPs
+
*5 ul 2mM dNTPs
-
32.5 ul H2O
+
*32.5 ul H2O
Program
Program
-
2 min initial denature at 94oC
+
*2 min initial denature at 94oC
-
30 sec denature at 94oC
+
*30 sec denature at 94oC
-
30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
+
*30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
-
30 sec extension at 68oC
+
*30 sec extension at 68oC
-
repeat 2-4 30 times total
+
*repeat 2-4 30 times total
</pre>
</pre>

Revision as of 13:38, 12 March 2013

Theodore A Chavkin 10:08, 12 March 2013 (PST)

Running Zymo Cleanup on PCA1:

Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.

Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction.
Transfer into the Zymo column (small clear guys)
spin through, discard waste.
Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol)
spin through, discard waste.
Add 200 uL of Zymo Wash Buffer
spin through, discard waste.
spin for 90 seconds, full speed to dry.
elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction

Running PCA2:

Recipe
*1 ul each outer oligo (10 uM)
*1 ul purified pca product
*.5 ul phusion
*10 ul 5x phusion buffer
*5 ul 2mM dNTPs
*32.5 ul H2O
Program
*2 min initial denature at 94oC
*30 sec denature at 94oC
*30 sec anneal at 60oC [This should be high, as your outer oligos now have a huge overlap with the correct product]
*30 sec extension at 68oC
*repeat 2-4 30 times total

Theodore A Chavkin 11:51, 5 March 2013 (PST)


PCA1 quiC-2_oligo[1-16]			(471bp, pca1)
PCA2 quiC-2_oligo3/6 on pca1		(471bp, quiC2)
Digest quiC2					(EcoRI/BamHI, 426+26+19bp, L, quiC2dig)
Digest pBca9145-Bca114#5			(EcoRI/BamHI, 2057+910bp, L, vectdig)
Ligate quiC2dig + vectdig			(pTC001)

>quiC2
ATATAGATGCCGTCCTAGCGAATTCATGAGATCTGCATCGTCTCAATACGGAACAAACGTTAGAACTATGACCTTGCCAGGTTTAGTCTTGCAAGATGTTAATGGTGTTACTTTGAAGGGATTAGACGTTCATAGGTTCTGTATAGGAGTCTTAGTTAACAGATCATCTAACAATTTAATTCAACACAATAGAATATCAAACAATTACGGAGGTGCCGGTGTCATGATTACTGGTGATGATGGTAAAGGTAACCCAACTTCTACCACAACTAACAACAATAAAGTCTTAGATAATGTCTTTATTGATAATGGTGATGGTTTAGAGTTAACTAGAGGTGCTGCTTTTAATTTAATTGCTAATAATTTATTCACATCAACTAAGGCTAATCCTGAACCATCACAAGGTATCGAAATTTTGTGGGGTAACGATAATGTGAGACGGCATGGATCCTGGGCACAGGAAAGATACTT
>pTC001
AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTGCATCGTCTCAATACGGAACAAACGTTAGAACTATGACCTTGCCAGGTTTAGTCTTGCAAGATGTTAATGGTGTTACTTTGAAGGGATTAGACGTTCATAGGTTCTGTATAGGAGTCTTAGTTAACAGATCATCTAACAATTTAATTCAACACAATAGAATATCAAACAATTACGGAGGTGCCGGTGTCATGATTACTGGTGATGATGGTAAAGGTAACCCAACTTCTACCACAACTAACAACAATAAAGTCTTAGATAATGTCTTTATTGATAATGGTGATGGTTTAGAGTTAACTAGAGGTGCTGCTTTTAATTTAATTGCTAATAATTTATTCACATCAACTAAGGCTAATCCTGAACCATCACAAGGTATCGAAATTTTGTGGGGTAACGATAATGTGAGACGGCATGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAAT

Protocol:
1.	38 uL ddH2O
2.	5 ul 10x expand buffer
3.	5 ul 2mM dNTPs
4.	1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks)
5.	0.75 ul Expand polymerase
Program:
1.	2 min initial denature at 94oC
2.	30 sec denature at 94oC
3.	30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed]
4.	30 sec extension at 72oC
5.	repeat 2-4 30 times total

A wild conrad appears!! Image:Conradmckinnon_1334093179_49.jpg
Ted used edit!
It's super effective!

Personal tools