SEED/2008/Day 3: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 1: Line 1:
== Morning ==
== Morning ==
* miniprep pSB4A5 cultures (x2)
* SEED Academy Assembly (no class)
** Each group will do two minipreps
** elute in 30ul
* spec miniprep concentrations (over lunch, instructor)


== Afternoon ==
== Afternoon ==
* Set up 50ul PCRs with 2 different forward RBS primers
* each group will miniprep 1.5ml of pSB4A5.I52001 and pSB1A3.E0050 cultures
** 5ul 10x NovaTaq Buffer with MgCl<sub>2</sub>
** elute in 30ul
** 1ul dNTP mix (10mM each dNTP)
* spec miniprep concentrations
** 1ul reverse primer (VR)
** 1ul RBS specific forward primer
** 0.25ul NovaTaq DNA polymerase
** 0.5ul DNA template of E0050 (10ng)
** rest PCR grade water
* Cycle 30 times
** 30s@94C
** 30s@55C
** 1m@72C
 
* Set up one 50ul digest of pSB4A5 with EcoRI and PstI
* Set up one 50ul digest of pSB4A5 with EcoRI and PstI
** 5ul NEB2
** 5ul NEB2
Line 45: Line 32:


== Instructor Preparation ==
== Instructor Preparation ==
* miniprep 1A3.[[registry:Part:BBa_E0050|E0050]] (PCR template)
* grow up cultures of pSB4A5.[[registry:Part:BBa_I52001|I52001]] (destination vector) and 1A3.[[registry:Part:BBa_E0050|E0050]] (PCR template)
* grow up cultures of pSB4A5.[[registry:Part:BBa_I52001|I52001]] (destination vector)
* Oligos
** VR: attaccgcctttgagtgagc
** B0030.E0040-F: gaattctctagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttc
** B0031.E0040-F: gaattctctagagtcacacaggaaacctactagatgcgtaaaggagaagaacttttc
** B0032.E0040-F: gaattctctagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttc
** B0033.E0040-F: gaattctctagagtcacacaggactactagatgcgtaaaggagaagaacttttc
** B0034.E0040-F: gaattctctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc
** B0035.E0040-F: gaattctctagagattaaagaggagaatactagatgcgtaaaggagaagaacttttc
* Pairs of RBS primers to assign to groups (selected based on estimated strength):
** B0030 & B0032
** B0031 & B0035
** B0033 & B0034
** B0032 & B0033
** B0031 & B0034
** B0030 & B0035


== Instructor Post-prep ==
== Instructor Post-prep ==
* store minipreps/PCRs in freezer
* heat kill and store miniprep digests in freezer

Revision as of 16:19, 7 March 2008

Morning

  • SEED Academy Assembly (no class)

Afternoon

  • each group will miniprep 1.5ml of pSB4A5.I52001 and pSB1A3.E0050 cultures
    • elute in 30ul
  • spec miniprep concentrations
  • Set up one 50ul digest of pSB4A5 with EcoRI and PstI
    • 5ul NEB2
    • 0.5ul BSA
    • 2.5ug pSB4A5 miniprep
    • 1ul EcoRI
    • 1ul PstI
  • leave in 37C incubator overnight

Lecture

  • PCR discussion
  • What is Synthetic Biology?
    • Tie in Comic
    • General, Very High Level Methods (Standardization, Abstraction, Encapsulation)
    • General hierarchy (Parts, Devices, Systems)
    • Rational Design from Ground Up
  • Who is involved?
    • Scientists, Engineers, Students, Hobbyists, Politicians
  • Why should we care?
    • Project Ideas Homework Discussion
    • Environment, Energy, Medicine, Materials, Chemicals, Computing
    • Understanding of Regulation, Function, Design (Minimal systems)
  • What are you going to learn and do in this class?
    • Cloning Process Overview
    • Characterization

Instructor Preparation

  • grow up cultures of pSB4A5.I52001 (destination vector) and 1A3.E0050 (PCR template)

Instructor Post-prep

  • heat kill and store miniprep digests in freezer
Retrieved from "https://openwetware.org/mediawiki/index.php?title=SEED/2008/Day_3&oldid=189835"