SIL071906-Construction of pSB1A2-J23014

From OpenWetWare

Revision as of 14:29, 24 July 2006 by Pineapplequeen (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

[trbCf]
PCR JL14/JL15 on Olambda (679bp, EcoRI/SpeI, Neb2)
Paste into pSB1A2-I13521 (EcoRI/SpeI, Neb2, Large 2062)
Product is pSB1A2-J23014


JL14 Forward EcoRI oligo to bioBrick trbC:
CCTAGGAATTCGCGGCCGCTTCTAGatgaagctgagtatgaaatc
JL15 Reverse SpeI oligo to bioBrick trbC:
gacttACTAGTcgtttcatttcccggaatctc

JL16 Forward trbCf 20mer
gctggcgttaccagatggtg
JL17 Reverse trbCf 20mer
gccctgaatactgctgcttcc

Personal tools