Sacks:RAD-seq
Overview
This is a protocol for generating RAD libraries for Illumina sequencing. With this technique, 96 samples can be multiplexed into one sequencing library, and only tags adjacent to PstI sites are sequenced. This is a cheap way to both mine and genotype large numbers of SNPs. This is the protocol developed in Erik Sacks' lab at UIUC by Lindsay Clark, based on protocols from Pat Brown and Megan Hall.
Materials
Reagents
- Quant-iT Picogreen kit (Invitrogen)
- Qiagen gel purification kit
- Qiagen PCR cleanup kit
- From New England Biolabs:
- PstI-HF, 20,000 U/mL
- MspI, 20,000 U/mL
- T4 DNA ligase, 2,000,000 U/mL
- ATP
- Phusion High Fidelity PCR master mix
Note: MspI is not a heat-inactivated enzyme, but I have found that the protocol works anyway. Between the ligation and gel extraction steps, I keep the sample on ice to prevent any residual digestion activity.
- You will also need a black microtiter plate for the Picogreen assay.
Oligonucleotides
PstI adapters
This is the most expensive part of the protocol other than the sequencing itself, since 192 oligonucleotides must be ordered.
Adapter 1 top: 5'GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA3'
Adapter 1 bottom: 5'yyyyAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATC3'
Where xxxx
and yyyy
are the barcode and its reverse complement, respectively.
Barcodes and oligo sequences are from Pat Brown's lab.
Other oligos
MspI adapters:
- A2top:
5'CGCTCAGGCATCACTCGATTCCTCCGAGAACAA3'
- A2bot:
5'CAAGCAGAAGACGGCATACGACGGAGGAATCGAGTGATGCCTGAG3'
Illumina PCR primers:
- PCR1:
5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3'
- PCR2:
5'CAAGCAGAAGACGGCATACGA3'
Equipment
- Nanodrop spectrophotometer
- BioTek Synergy plate reader (for reading fluorescence)
- Ordinary PCR machine
- Agarose gel rig
- Bioanalyzer
- real-time PCR machine (we just pay the core facility to do that part)
Procedure
Adapter prep
Top and bottom strands of adapters need to be annealed 1X Annealing Buffer, which is 10 mM Tris, 50 mM NaCl.
The annealing program is:
- 95°C 5 minutes
- Ramp down -0.1°C every 2 seconds (or -1°C every 20 seconds) to 25°C.
My protocol:
- Pat Brown provided us with a plate of PstI adapters that are at 1 μM. I took a bottle of autoclaved 1X Annealing Buffer, added 45 μl to each well of a 96-well plate, then transferred 5 μl from the 1 μM plate to make a 0.1 μM working stock.
- MspI adapters are ordered like normal oligos, and I have 100 μM concentrated stocks in TE. To make a 10 μM stock:
- 20 μl A2top, 100 μM
- 20 μl A2bot, 100 μM
- 20 μl 500 mM NaCl
- 2 μl 1M Tris
- 138 μl nuclease-free water
- Mix well, add 100 μl to each of two PCR tubes, and run them on the annealing program ("Adapt" on the PCR machine).
DNA quantification and dilution
Restriction digestion and ligation
Cleanup and amplification
Quality control
Bioinformatics
Notes
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!
- List troubleshooting tips here.
- You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
- Anecdotal observations that might be of use to others can also be posted here.
Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
References
- Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, and Mitchell SE (2011) "A robust, simple Genotyping-by-Sequencing (GBS) approach for high diversity species." PLoS One 6(5): e19379. doi:10.1371/journal.pone.0019379
Contact
- Who has experience with this protocol?
or instead, discuss this protocol.