SbsB DNA Sequence

From OpenWetWare

Revision as of 12:06, 5 August 2005 by Norville (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

>gi|1418403|emb|X98095.1|BSSBSBGEN B.stearothermophilus sbsB gene ATTATAAAAATATAAAAAATACACAAAACGGGGAGGAAATTATTCATGGCTTATCAACCTAAGTCCTATC GCAAGTTTGTTGCGACAACTGCAACAGCTGCCATGGTAGCATCTGCGGTAGCTCCTGTAGTATCTGCAGC AAGCTTCACAGATGTTGCGCCGCAATATAAAGATGCGATCGATTTCTTAGTATCAACTGGTGCAACAAAA GGTAAAACAGAAACAAAATTCGGCGTTTACGATGAAATCACTCGTCTAGATGCGGCAGTTATTCTTGCAA GAGTATTAAAACTAGACGTTGACAACGCAAAAGACGCAGGCTTCACAGATGTGCCAAAAGACCGTGCAAA ATACGTCAACGCGCTTGTAGAAGCTGGCGTATTAAACGGTAAAGCACCTGGCAAATTTGGTGCATACGAC CCATTAACTCGCGTTGAAATGGCAAAAATCATCGCGAACCGTTACAAATTAAAAGCTGACGATGTAAAAC TTCCATTCACTGATGTAAACGATACATGGGCACCATACGTAAAAGCGCTTTATAAATACGAAGTAACAAA AGGTAAAACACCAACAAGCTTCGGTGCATACCAAAACATCACTCGCGGTGACTTTGCGCAATTTGTATAT AGAGCGGTGAATATTAATGCAGTGCCAGAAATAGTTGAAGTAACTGCGGTTAATTCGACTACAGTGAAAG TAACATTCAATACGCAAATTGCTGATGTTGATTTCACAAATTTTGCTATCGATAACGGTTTAACTGTTAC TAAAGCAACTCTTTCTCGTGATAAAAAATCCGTAGAGGTTGTGGTAAATAAACCGTTTACTCGTAATCAG GAATATACAATTACAGCGACAGGCATTAAAAATTTAAAAGGCGAGACCGCTAAGGAATTAACTGGTAAGT TTGTTTGGTCTGTTCAAGATGCGGTAACTGTTGCACTAAATAATAGTTCGCTTAAAGTTGGAGAGGAATC TGGTTTAACTGTAAAAGATCAGGATGGCAAAGATGTTGTAGGTGCTAAAGTAGAACTTACTTCTTCTAAT ACTAATATTGTTGTAGTTTCAAGTGGCGAAGTATCAGTATCTGCTGCTAAAGTTACAGCTGTAAAACCGG GAACAGCTGATGTTACTGCAAAAGTTACATTACCAGATGGTGTTGTACTAACAAATACATTTAAAGTGAC AGTTACAGAAGTGCCTGTGCAAGTACAAAATCAAGGATTTACTTTAGTTGATAATCTTTCTAATGCTCCA CAGAATACAGTTGCATTTAACAAAGCTGAGAAAGTAACTTCAATGTTTGCTGGAGAAACTAAAACAGTTG CAATGTATGATACTAAAAACGGTGATCCTGAAACTAAACCTGTTGATTTCAAAGATGCAACTGTACGTTC ATTAAATCCAATTATTGCAACAGCTGCTATTAATGGTAGTGAGCTCCTTGTCACAGCTAATGCTGGCCAA TCTGGAAAAGCTTCATTTGAAGTAACATTTAAAGATAATACAAAAAGAACATTTACAGTTGATGTGAAAA AAGACCCTGTATTACAAGATATTAAAGTAGATGCAACTTCTGTTAAACTTTCCGATGAAGCTGTTGGCGG CGGGGAAGTTGAAGGAGTTAACCAAAAAACGATTAAAGTAAGTGCAGTTGACCAATACGGTAAAGAAATT AAATTTGGTACAAAAGGTAAAGTTACTGTTACAACTAATACAGAAGGACTAGTTATTAAAAATGTAAATA GCGATAATACAATTGACTTTGATAGCGGCAATAGTGCAACTGACCAATTTGTTGTCGTTGCAACAAAAGA CAAAATTGTCAATGGTAAAGTAGAAGTTAAATATTTCAAAAATGCTAGTGACACAACACCAACTTCAACT AAAACAATTACTGTTAATGTAGTGAATGTAAAAGCTGACGCTACACCAGTAGGATTAGATATTGTAGCAC CTTCTGAAATTGATGTGAATGCTCCAAACACTGCTTCTACTGCAGATGTTGATTTTATTAATTTCGAAAG TGTTGAGATTTATACACTCGATTCTAATGGTAACCGTCTTAAAAAAGTTACTCCAACTGCAACTACACTT GTAGGTACTAATGATTATGTTGAAGTTAATGGGAATGTATTACAATTCAAGGGTAACGATGAATTAACGC TATTAACTTCTTCTAGTACAGTAAACGTTGATGTAACAGCTGATGGAATTACAAAACGTATTCCAGTAAA ATATATCAACTCTGCAAGTGTACCTGCCAGTGCAACAGTAGCAACAAGTCCTGTTACTGTTAAGCTTAAT TCAAGTGATAATGATTTAACATTTGAAGAATTAATATTCGGTGTAATTGACCCTACACAATTAGTCAAAG ATGAAGACATCAACGAATTTATTGCAGTTTCAAAAGCGGCTAAAAATGATGGATATTTGTATAATAAACC GCTTGTAACGGTTAAAGATGCATCAGGAAAAGTTATTCCAACAGGTGCAAATGTTTACGGTCTAAATCAT GATGCAACTAACGGAAACATTTGGTTTGATGAGGAACAAGCTGGCTTAGCTAAAAAATTTAGTGATGTAC ATTTTGATGTTGATTTTTCATTAGCTAACGTTGTAAAAACTGGTAGCGGTACAGTTTCTTCATCGCCATC ATTATCTGACGCAATTCAACTTACTAATTCAGGCGATGCAGTATCGTTTACATTAGTTATCAAATCAATT TATGTTAAAGGCGCAGATAAAGATGATAATAACTTACTTGCAGCCCCTGTTTCTGTCAATGTGACTGTGA CAAAATAATTTTGAGGTTCGGTCTCTGTTACCATTTGAAAAATGCCGAAAAGCTCTGCGGAGAGAAATCT CTGCGGGGCTTTTCTTTTTGGTTCTATGTCAATTGTTGAGGTGCAT

Personal tools