Sean Lauber:Kras G12D Genotyping: Difference between revisions
No edit summary |
No edit summary |
||
(2 intermediate revisions by the same user not shown) | |||
Line 18: | Line 18: | ||
0.5 ul template (from DirectPCR) | 0.5 ul template (from DirectPCR) | ||
0.1 ul Platinum Taq | 0.1 ul Platinum Taq | ||
18.65 ul sterile water | |||
-------- | -------- | ||
25 ul | 25 ul | ||
*primer 73/74B are mixed together, so add 2 ul of this mix | *primer 73/74B are mixed together, so add 2 ul of this mix | ||
5. PCR is then performed with the following parameters: | 5. PCR is then performed with the following parameters (load program: KRAS): | ||
94°C 3 min (initial denaturation) | 94°C 3 min (initial denaturation) | ||
Line 31: | Line 31: | ||
72°C 1 min (final extension) | 72°C 1 min (final extension) | ||
6. | 6. Once the PCR reaction is complete, add 5 ul of EZvision DNA loading dye to the 25 ul reaction and mix. Then load 15 ul of this into a 1% agarose gel (0.6 g agarose in 60 ml TBE, microwave for 2 min, let cool and pour to set) along with 1 ul of a 100 bp ladder (1 ul ladder + 1 ul EZVision + 4 ul water). | ||
7. The gel is run at 80 V for 1.5 hours and then imaged. Products at 600 bp are indicative of heterozygote | 7. The gel is run at 80 V for 1.5 hours and then imaged. Products at 600 bp are indicative of heterozygote |
Latest revision as of 11:40, 16 October 2012
This protocol makes use of the DirectPCR mouse tail lysis reagent (Viagen, cat 102-T) to obtain template and the hot start Platinum Taq (Invitrogen, cat 10966-026). 1 mm tail ends are collected from mice (typically at 4-6 weeks) and the tail is degraded using the DirectPCR reagent before use in PCR.
1. 125 ul of DirectPCR reagent and 4.73 ul of Proteinase K are added to each tube containing a 1 mm tail snip
2. The tubes are heated at 55°C O/N
3. The tubes are heated at 85°C for 45 min to inactivate the proteinase K
4. After vortexing briefly, 0.5 ul of this template is added to a PCR reaction along with the other reagents:
FOR EACH PCR REACTION: 2.5 ul 10X PCR buffer 0.5 ul 10 uM dNTPs 0.75 ul 50 mM MgCl2 1 ul 25 uM primer 74B* 1 ul 25 uM primer 73B* 0.5 ul template (from DirectPCR) 0.1 ul Platinum Taq 18.65 ul sterile water -------- 25 ul *primer 73/74B are mixed together, so add 2 ul of this mix
5. PCR is then performed with the following parameters (load program: KRAS):
94°C 3 min (initial denaturation) 94°C 0.5 min (cycle*35 denature) 55°C 1 min (cycle*35 anneal) 72°C 1 min (cycle *35 extend) 72°C 1 min (final extension)
6. Once the PCR reaction is complete, add 5 ul of EZvision DNA loading dye to the 25 ul reaction and mix. Then load 15 ul of this into a 1% agarose gel (0.6 g agarose in 60 ml TBE, microwave for 2 min, let cool and pour to set) along with 1 ul of a 100 bp ladder (1 ul ladder + 1 ul EZVision + 4 ul water).
7. The gel is run at 80 V for 1.5 hours and then imaged. Products at 600 bp are indicative of heterozygote
Primers used:
73B: TCTACAGTCTGCGTGCGCTTGTAA
74B: GTAAGTCTGCAGGTCGAGGGAC