Sean Lauber:Kras G12D Genotyping

This protocol makes use of the DirectPCR mouse tail lysis reagent (Viagen, cat 102-T) to obtain template and the hot start Platinum Taq (Invitrogen, cat 10966-026). 1 mm tail ends are collected from mice (typically at 4-6 weeks) and the tail is degraded using the DirectPCR reagent before use in PCR.

1. 125 ul of DirectPCR reagent and 4.73 ul of Proteinase K are added to each tube containing a 1 mm tail snip

2. The tubes are heated at 55°C O/N

3. The tubes are heated at 85°C for 45 min to inactivate the proteinase K

4. After vortexing briefly, 0.5 ul of this template is added to a PCR reaction along with the other reagents:

 FOR EACH PCR REACTION:
 2.5 ul   10X PCR buffer
 0.5 ul   10 uM dNTPs
 0.75 ul  50 mM MgCl2
 1 ul     25 uM primer 74B*
 1 ul     25 uM primer 73B*
 0.5 ul   template (from DirectPCR)
 0.1 ul   Platinum Taq
 17.75 ul sterile water
 --------
 25 ul  
 *primer 73/74B are mixed together, so add 2 ul of this mix

5. PCR is then performed with the following parameters:

 94°C  3 min (initial denaturation)
 94°C  0.5 min (cycle*35 denature)
 55°C  1 min (cycle*35 anneal)
 72°C  1 min (cycle *35 extend)
 72°C  1 min (final extension)

6. 10 ul of the PCR reaction is combined with 2 ul of EZVision DNA binding dye and loaded into a 1% agarose gel (0.75 g agarose in 75 ml TBE, microwave for 2 min, let cool and pour to set) along with 1 ul of a 100 bp ladder

7. The gel is run at 80 V for 1.5 hours and then imaged. Products at 600 bp are indicative of heterozygote

Primers used:

73B: TCTACAGTCTGCGTGCGCTTGTAA

74B: GTAAGTCTGCAGGTCGAGGGAC