Sex genotyping of mice

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Sry PCR)
Line 3: Line 3:
If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [http://tinyurl.com/65hwmtj] can be used.
If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [http://tinyurl.com/65hwmtj] can be used.
-
=== Common male-specific PCRs ===
+
== Common male-specific PCRs ==
-
===='''Sry''' Sex-determining region of the Y chromosome [http://www.ncbi.nlm.nih.gov/gene/21674] ====
+
==='''Sry''' Sex-determining region of the Y chromosome [http://www.ncbi.nlm.nih.gov/gene/21674] ===
* forward SRY F :  TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
* forward SRY F :  TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
* reverse SRY R :  CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
* reverse SRY R :  CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
-
: PCR product: 273 base pair PCR product
+
* PCR product: 273 base pair PCR product
-
[http://mgc.wustl.edu/Protocols/PCRGenotypingPrimerPairs/tabid/154/Default.aspx Uni Washington, St. Louis, Mouse Genetics Core]
+
: [http://mgc.wustl.edu/Protocols/PCRGenotypingPrimerPairs/tabid/154/Default.aspx Uni Washington, St. Louis, Mouse Genetics Core]
* forward sry1 AACAACTGGGCTTTGCACATTG  
* forward sry1 AACAACTGGGCTTTGCACATTG  
* reverse sry2 GTTTATCAGGGTTTCTCTCTAGC
* reverse sry2 GTTTATCAGGGTTTCTCTCTAGC
-
: PCR product: 166, 146 bp doublet
+
* PCR product: 166, 146 bp doublet
-
[http://www.mmrrc.org/strains/10318/di_protocol.pdf MMRRC's genotyping protocol including Sry primers]
+
: [http://www.mmrrc.org/strains/10318/di_protocol.pdf MMRRC's genotyping protocol including Sry primers]

Revision as of 09:00, 6 April 2011

While adult mice can be readily sexed using anatomical features, young male and female mouse embryos are not yet sufficiently developed to assess their sex. In fact, their genital tubercles look superficially identical. At E16, only about 4 days before birth, the tubercle looks like this: E16 genital tubercles in Baskin's book, p. 108, figure 2.

If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [1] can be used.

Common male-specific PCRs

Sry Sex-determining region of the Y chromosome [2]

  • forward SRY F : TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
  • reverse SRY R : CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
  • PCR product: 273 base pair PCR product
Uni Washington, St. Louis, Mouse Genetics Core
  • forward sry1 AACAACTGGGCTTTGCACATTG
  • reverse sry2 GTTTATCAGGGTTTCTCTCTAGC
  • PCR product: 166, 146 bp doublet
MMRRC's genotyping protocol including Sry primers
Personal tools