Short Overhang Construction Plasmid

Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.

We plan on distributing the prepared construction plasmid as purified PCR products, diluted to standard concentration, but prior to cutting with EcoRI and PstI. Standard assembly will cut this plasmid backbone with EcoRI and PstI at the same time that the two assembled fragments are cut with EcoRI and SpeI and with XbaI and PstI, respectively.

The preparation of this PCR fragment is done with primers having short overhangs past the EcoRI and PstI sites, followed by DpnI digestion of the template, to eliminate background plasmid transformation, followed by PCR cleanup, dilution to standard concentration, and quality control testing.

Primers

ccgctgcagtccggcaaaaaaacg,SB-prep-2P
gccgctgcagtccggcaaaaaaacg,SB-prep-3P
ggccgctgcagtccggcaaaaaaacg,SB-prep-4P
gcgaattccagaaatcatccttagcg,SB-prep-2E
cgcgaattccagaaatcatccttagcg,SB-prep-3E
ccgcgaattccagaaatcatccttagcg,SB-prep-4E

Dilute to 30 pmol/ul

PCR

• 100 ul PCR supermix
• 1.5 ul each primer
• 1 ul template DNA at 10 ng/ul
• cycle 95/2 min; 36x(94/30s;55/30s;68/4.5 min); 68/20 min
• Add 1 ul DpnI enzyme
• Incubate 37/1 hour; heat kill 80/20 min

Cleanup

• Add 500 ul Qiagen buffer PB
• Spin through a column twice, discard flowthrough
• Wash 1x with 700 ul buffer PB
• Wash 2x with 760 ul buffer PE
• Discard liquid, spin dry at 17000g for 3 min
• Elute into a new tube twice with 50 ul of TE (100 ul total)

QC

• Run 3 ul on a gel to verify the correct band and concentration and lack of side products
• Quantify concentration on a nanodrop. Expect around 10 ug from a 100 ul PCR reaction (100 ng/ul in 100 ul)
• Perform a ligation test
  • Test for both the EcoRI and PstI cutting and ligation efficiency
  • Digest in a 15 ul final volume
  • 1 ul DNA (approximately 100 ng)
  • 1.5 ul NEB Buffer 4
  • .15 ul BSA
  • 0.5 ul either EcoRI-HF or PstI enzyme
  • 12 ul water
  • Digest 37/1 hour; 80/20 min
  • Add 5 ul of a 4x ligation master mix
  • Ligate 30 min at room temperature
  • run all 20 ul on a gel
  • Compare instensity of the single and double length bands. Good product should show mostly double length bands.
• Ligation master mix
  • 50 ul final
  • 20 ul T4 DNA ligase buffer
  • 5 ul T4 DNA ligase
  • 25 ul water
• Transformation test
  • Transform 1 ul of the diluted final product into highly competent cells
  • plate on the appropriate antibiotic
  • observe few colonies. Any colonies represent background to the three antibiotic assembly process