Silver: PCR
From OpenWetWare
(Difference between revisions)
(→B. PCR from yeast chromosomal or plasmid template) |
Current revision (11:18, 7 June 2010) (view source) (→Condition C: Phusion Polymerase) |
||
| (11 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
DESIGN & PREPARATION OF OLIGONUCLEOTIDE INSERTS FOR INSERTS ~ 85 BP AND LARGER: PRIMER AMPLIFICATION OF YEAST DNA | DESIGN & PREPARATION OF OLIGONUCLEOTIDE INSERTS FOR INSERTS ~ 85 BP AND LARGER: PRIMER AMPLIFICATION OF YEAST DNA | ||
| + | *we need a new PCR machine!! | ||
== A. Primer design for PCR == | == A. Primer design for PCR == | ||
| - | *For typical BioBricks construction, you want a PCR product which has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part. <br>Then, the forward primer should be of the form: <br>5' CCTTTCTAGA (15-20 bp | + | *For typical BioBricks construction, you want a PCR product which has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part. <br>Then, the forward primer should be of the form: <br>5' CCTTTCTAGA (15-20 bp of the coding strand) 3' <br>and the reverse primer should be of the form: <br>5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3' |
*Design considerations. Make sure that: | *Design considerations. Make sure that: | ||
** The T<sub>m</sub> of each primer is between 55-65 °C | ** The T<sub>m</sub> of each primer is between 55-65 °C | ||
| Line 25: | Line 26: | ||
Both are known to work. | Both are known to work. | ||
My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn't get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) -- Pfx has worked for *all* pcr reactions I've tried. | My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn't get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) -- Pfx has worked for *all* pcr reactions I've tried. | ||
| - | === Condition A === | + | === Condition A: Vent polymerase === |
#Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM. | #Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM. | ||
#Mix: | #Mix: | ||
| Line 43: | Line 44: | ||
#*End: keep at 4 °C forever | #*End: keep at 4 °C forever | ||
| - | === Condition B === | + | === Condition B: Pfx Polymerase === |
#Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM. | #Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM. | ||
| + | #Use Stratagene's Pfx kit. | ||
#Mix: | #Mix: | ||
| - | #* 3 µL primer mix | + | #* 3 µL primer mix (10µM of each primer) |
#* 0.8 µL template DNA | #* 0.8 µL template DNA | ||
#* 25 µL 10X PFx amplification buffer | #* 25 µL 10X PFx amplification buffer | ||
| Line 57: | Line 59: | ||
#*Start: 94 °C for 5 min. (melt) | #*Start: 94 °C for 5 min. (melt) | ||
#*Cycle 94 °C for 15 sec (melt) (cycle start) | #*Cycle 94 °C for 15 sec (melt) (cycle start) | ||
| - | #* | + | #*55 °C for 0.5 min. (anneal) |
#*68 °C for 3.5 min (extension) (cycle end) | #*68 °C for 3.5 min (extension) (cycle end) | ||
#*68 °C for 7 min | #*68 °C for 7 min | ||
#*No. of Cycles: 35 | #*No. of Cycles: 35 | ||
#*End: keep at 4 °C forever | #*End: keep at 4 °C forever | ||
| + | |||
| + | |||
| + | === Condition C: Phusion Polymerase=== | ||
| + | #Use [http://www.neb.com/nebecomm/products/productf-530.asp NEB Phusion Polymerase Kit] | ||
| + | #Mix: | ||
| + | #* 10 µL Phusion Buffer | ||
| + | #* 1 µL 10mM dNTPs | ||
| + | #* 2.5 µL Forward Primer (10 µM) | ||
| + | #* 2.5 µL Reverse Primer (10 µM) | ||
| + | #* 2 µL Genomic Template (less for plasmid template) | ||
| + | #* 0.5 µL Phusion polymerase | ||
| + | #* 31.5 µL Distilled Water (up to 50 µL) | ||
| + | #PCR Program | ||
| + | #*Start: 98 °C for 30 sec. | ||
| + | #*Cycle: 98 °C for 10 sec. | ||
| + | #*45-72 °C for 15 sec. (use 3 degrees above the primer Tm for annealing temperature) | ||
| + | #*72 °C for 15-30 sec./kb | ||
| + | #*No. of Cycles: 25-35 | ||
| + | #*72 °C for 5-10 min. | ||
| + | #*End: 4 °C forever | ||
== C. Gel analysis and purification of PCR products == | == C. Gel analysis and purification of PCR products == | ||
| - | *Run | + | * Run the PCR reaction on an appropriate percentage agarose gel and purify using Qiagen's PCR purification kit. Elute with 30 µL or another volume depending on the band's brightness. |
| - | + | ||
| - | + | [[Category:Protocol]] | |
| + | [[Category:DNA]] | ||
| + | [[Category:In vitro]] | ||
Current revision
DESIGN & PREPARATION OF OLIGONUCLEOTIDE INSERTS FOR INSERTS ~ 85 BP AND LARGER: PRIMER AMPLIFICATION OF YEAST DNA
- we need a new PCR machine!!
Contents |
A. Primer design for PCR
- For typical BioBricks construction, you want a PCR product which has an XbaI site upstream of your part, and SpeI, NotI, and PstI sites downstream of your part.
Then, the forward primer should be of the form:
5' CCTTTCTAGA (15-20 bp of the coding strand) 3'
and the reverse primer should be of the form:
5' AAGGCTGCAGCGGCCGCTACTAGT (15-20 bp reverse complement) 3' - Design considerations. Make sure that:
- The Tm of each primer is between 55-65 °C
- The Tm of both primers are very similar, i.e., within ~2 °C
- Either primer will not form a stable internal hairpin structure, i.e., ΔG <-3 kcal/mol
- The forward and reverse primers do not combine to form a stable hairpin structure or dimer
- The genomic DNA to be amplified does not contain any EcoRI, PstI, SpeI, XbaI, or AarI sites
- The insert for the forward primer does not begin with TC (or else a DAM I site (GATC) is formed, and XbaI cannot cut)
- If possible the 3' end of each primer should end with a GC
- An easy way to design primers is to use Vector NTI.
- Find the genomic DNA sequence that you want to amplify as your part at yeastgenome.org and save it into Vector NTI.
- Highlight the sequence that you want as your part, and select Analyses -> Primer Design -> Amplify Selection.
- Under the Primer tab, set "Before" and "After" to 0 bp. Adjust the Tm, primer length, GC content, et c. as noted above. Also click More>> and insert the flanking sense and anti-sense sequences (given at top) in the boxes "Attach to 5' terminus of Sense primer" and "Attach to 5' terminus of Anti-sense primer". Lastly, click "Apply" then "OK."
- Three possible sets of designed primers will appear in a folder on the left side of the screen, ranked by their score. Usually, the best possible score is 171. The lowest score that I (Caroline) have successfully used is ~120.
- Double-check your primers by highlighting a given sequence, then right-clicking and selecting "Analyze".
- For more information, check out Vector NTI's user manual, Chapters 8 and 20.
- Order 25 nmol DNA oligo with standard desalting from IDT.
- Note: if it is not possible to make a good set of primers with the flanking regions described above, see if using a different set of flanking regions improves the primers. For example, you can also use a PCR product that has the EcoRI, NotI, and XbaI sites upstream of your part, while the SpeI site is downstream of your part. In this case, the forward primer would be of the form: 5' CCTTGAATTCGCGGCCGCATCTAGA (15-20 bp complement to coding strand)3' and the reverse primer should be of the form:
5' AAGGACTAGT (15-20 bp complement to coding strand) 3'.
B. PCR from yeast chromosomal or plasmid template
Both are known to work. My two cents (Caroline): Using Vent (condition A) works for most (>90%) parts. However, there have been few parts for which I couldn't get pcr products using condition A. I have been able to pcr out these difficult parts using Pfx (condition B) -- Pfx has worked for *all* pcr reactions I've tried.
Condition A: Vent polymerase
- Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
- Mix:
- 5 µL 10x ThermoPol buffer
- 0.4 µL 25 mM dNTPs
- 0.5 µL 100 µM forward primer
- 0.5 µL 100 µM reverse primer
- ≤1 µL plasmid DNA or 2 µL genomic DNA
- 1 µL Vent DNA polymerase
- distilled water to 50 µL total volume
- PCR program:
- Start: 95 °C for 2 min. (melt)
- Cycle 95 °C for 0.5 min (melt)
- Tm minus 5 °C for 0.5 min. (anneal)
- 74 °C for (# bp/1000) min. (extension) - no less than 0.5 min.
- No. of Cycles: 30
- End: keep at 4 °C forever
Condition B: Pfx Polymerase
- Resuspend each primer in Tris buffer pH 8.0 or distilled water to 100 µM.
- Use Stratagene's Pfx kit.
- Mix:
- 3 µL primer mix (10µM of each primer)
- 0.8 µL template DNA
- 25 µL 10X PFx amplification buffer
- 3 µL 10mM dNTPs
- 2 µL 50mM MgSO4
- 30 µL 10X PFx enhancer buffer
- 34.2 µL water (to 100 µL)
- 2 µL PFx DNA polymerase
- PCR Program
- Start: 94 °C for 5 min. (melt)
- Cycle 94 °C for 15 sec (melt) (cycle start)
- 55 °C for 0.5 min. (anneal)
- 68 °C for 3.5 min (extension) (cycle end)
- 68 °C for 7 min
- No. of Cycles: 35
- End: keep at 4 °C forever
Condition C: Phusion Polymerase
- Use NEB Phusion Polymerase Kit
- Mix:
- 10 µL Phusion Buffer
- 1 µL 10mM dNTPs
- 2.5 µL Forward Primer (10 µM)
- 2.5 µL Reverse Primer (10 µM)
- 2 µL Genomic Template (less for plasmid template)
- 0.5 µL Phusion polymerase
- 31.5 µL Distilled Water (up to 50 µL)
- PCR Program
- Start: 98 °C for 30 sec.
- Cycle: 98 °C for 10 sec.
- 45-72 °C for 15 sec. (use 3 degrees above the primer Tm for annealing temperature)
- 72 °C for 15-30 sec./kb
- No. of Cycles: 25-35
- 72 °C for 5-10 min.
- End: 4 °C forever
C. Gel analysis and purification of PCR products
- Run the PCR reaction on an appropriate percentage agarose gel and purify using Qiagen's PCR purification kit. Elute with 30 µL or another volume depending on the band's brightness.


