Something1
From OpenWetWare
Current revision (13:26, 16 April 2013) (view source) |
|||
| (23 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
<div class="tabs-blue"> | <div class="tabs-blue"> | ||
<ul> | <ul> | ||
| - | <li> [[User:Conrad | + | <li> [[User:Conrad McKinnon| Home]]</li> |
| - | <li id="current">[[something1 | | + | <li id="current">[[something1 | Lab Notebook]]</li> |
<li>[[something2|Protocols]]</li> | <li>[[something2|Protocols]]</li> | ||
<li>[[something3 | Tutorials]]</li> | <li>[[something3 | Tutorials]]</li> | ||
| Line 10: | Line 10: | ||
<br> | <br> | ||
<br> | <br> | ||
| + | [[Image:Conradmckinnon_1334093179_49.jpg]] | ||
| - | + | ==Beginning== | |
| + | <pre>Construction File | ||
| + | |||
| + | PCA1 quic-1 oligo (1-16) (455 bp, quiC-0) | ||
| + | PCA2 quic-1 oligo (14/16) (455 bp, quic1) | ||
| + | Digest quic-1 (EcoRI/BamHI 410+26+19, L, quicCdig) | ||
| + | Digest pBca9145-1144#5 (EcoRI/ BamHI, 2057+910, L, vectdig) | ||
| + | Ligate quic-1dig+vectdig (pCWM001) | ||
| + | |||
| + | |||
| + | >quiC-1 | ||
| + | |||
| + | GCATCGTCTCATCGGTCTCCTATGATGAAATTAACCTCTTTAAGGGTATCTTTGTTGGCCTTGGGTTTAGTTACATCAGGTTTCGCCGCCGCTGAAACCTATACTGTAGATAGATATCAAGACGACTCAGAGAAGGGATCTTTAAGATGGGCCATCGAACAGTCAAATGCCAACTCAGCTCAAGAAAACCAAATTTTGATCCAAGCTGTTGGTAAGGCACCTTACGTCATCAAAGTTGATAAACCATTACCTCCTATCAAATCTTCTGTTAAGATTATAGGTACTGAATGGGACAAAACAGGTGAGTTTATAGCCATTGATGGTTCTAACTATATCAAAGGAGAAGGTGAGAAAGCTTGTCCAGGAGCCAACCCTGGACAATACTGAGACGGCAT | ||
| + | |||
| + | >pCWM001 | ||
| + | |||
| + | aggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcatgagatctGcatcgtctcatcggtctccTATGATGAAATTAACCTCTTTAAGGGTATCTTTGTTGGCCTTGGGTTTAGTTACATCAGGTTTCGCCGCCGCTGAAACCTATACTGTAGATAGATATCAAGACGACTCAGAGAAGGGATCTTTAAGATGGGCCATCGAACAGTCAAATGCCAACTCAGCTCAAGAAAACCAAATTTTGATCCAAGCTGTTGGTAAGGCACCTTACGTCATCAAAGTTGATAAACCATTACCTCCTATCAAATCttctgttaagattataggtactgaatgggacaaaacaggtgagtttatagccaTTGATGGTTCTAACTATATCAAAGGAGAAGGTGAGAAAGCTTGTCCAGGAGCCAACCCTGGACAATACTGAGACGGCATggatcCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaat | ||
| + | |||
| + | Protocol: | ||
| + | 1. 38 uL ddH2O | ||
| + | 2. 5 ul 10x expand buffer | ||
| + | 3. 5 ul 2mM dNTPs | ||
| + | 4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) | ||
| + | 5. 0.75 ul Expand polymerase | ||
| + | Program (can run JCA/PCA1) | ||
| + | 1. 2 min initial denature at 94oC | ||
| + | 2. 30 sec denature at 94oC | ||
| + | 3. 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] | ||
| + | 4. 30 sec extension at 72oC | ||
| + | 5. repeat 2-4 30 times total | ||
| + | |||
| + | </pre> | ||
| + | |||
| + | Did the PCA on Friday | ||
| + | |||
| + | On monday the 12th started by doing the following | ||
| + | |||
| + | [[User:Conrad McKinnon|Conrad McKinnon]] 13:09, 12 March 2013 (EDT) | ||
| + | |||
| + | Regular Zymo Cleanup | ||
| + | |||
| + | The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction. | ||
| + | |||
| + | |||
| + | Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. (surprisingly this fit) | ||
| + | Transfer into the Zymo column (small clear guys) (this was the tube within a tube) | ||
| + | spin through, discard waste. (for 60-90seconds) | ||
| + | Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) | ||
| + | spin through, discard waste. | ||
| + | Add 200 uL of Zymo Wash Buffer | ||
| + | spin through, discard waste. | ||
| + | spin for 90 seconds, full speed to dry. | ||
| + | elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction | ||
| + | |||
| + | |||
| + | |||
| + | Then do PCA2 | ||
| + | |||
| + | 1 ul each outer oligo (10 uM) | ||
| + | 1 ul purified pca product | ||
| + | .5 ul phusion | ||
| + | 10 ul 5x phusion buffer | ||
| + | 5 ul 2mM dNTPs | ||
| + | 32.5 ul H2O | ||
| + | |||
| + | ==[[User:Conrad McKinnon|Conrad McKinnon]] 12:53, 19 March 2013 (EDT)== | ||
| + | |||
| + | First do a zymo clean up | ||
| + | |||
| + | The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction. | ||
| + | |||
| + | |||
| + | Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. | ||
| + | Transfer into the Zymo column (small clear guys) | ||
| + | spin through, discard waste. | ||
| + | Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) | ||
| + | spin through, discard waste. | ||
| + | Add 200 uL of Zymo Wash Buffer | ||
| + | spin through, discard waste. | ||
| + | spin for 90 seconds, full speed to dry. | ||
| + | elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction | ||
| + | |||
| + | then and eco/bamh1 digestion | ||
| + | |||
| + | |||
| + | [[User:Conrad McKinnon|Conrad McKinnon]] 12:42, 21 March 2013 (EDT) | ||
| + | So everything failed horribly and in a fire. Luckily for all those involved chris saved everything and created a perfect quic-1 digest. | ||
| + | |||
| + | Now for today, we are going to do: | ||
| + | |||
| + | Ligation of EcoRI/BamHI digests http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 | ||
| + | Transformation http://openwetware.org/wiki/Template:SBB-Protocols_Micro1 | ||
| + | |||
| + | ==[[User:Conrad McKinnon|Conrad McKinnon]] 17:05, 2 April 2013 (EDT)== | ||
| + | |||
| + | So almost all the colonies failed to grow, with only two of them succeeding. Both happened to be the end step of a compound and used EcoR/BglII to cut as opposed to BamH1 and BglII. Interesting | ||
| + | |||
| + | Anyways the job to do was to go back and redigest everything and then run a gel to confirm that we actually had something. I had something, which is good because chris had done the whole thing because my was fucked up to begin with so if nothing was there major problems. | ||
| + | |||
| + | Anyways on thursday we are going to ligate and transform them into bacteria again and see what shakes out. hopefully it works this time | ||
| + | |||
| + | ==[[User:Conrad McKinnon|Conrad McKinnon]] 12:48, 9 April 2013 (EDT)== | ||
| + | |||
| + | Got back the bacteria plates. My plate has around 10 colonies on it. We will now pick four and label four tubes. | ||
| + | |||
| + | ==[[User:Conrad McKinnon|Conrad McKinnon]] 13:48, 11 April 2013 (EDT)== | ||
| + | |||
| + | The overall plan is as follows. | ||
| + | |||
| + | *. 1. Miniprep our colonies. | ||
| + | http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 | ||
| + | note, we didn't clean up, we are gel purifying. | ||
| + | *. 2. restriction map with EcoR1/Xho1 | ||
| + | made a mastermix with | ||
| + | *30 ul water | ||
| + | *5 ul buffer | ||
| + | *2.5 Xho1 | ||
| + | *2.5 EcoR1 | ||
| + | |||
| + | then add 7.5 ul of this to each tube with 2 ul of DNA in it | ||
| + | |||
| + | *. 3. We then run a gel | ||
| + | *. 4. Then we put all the juice from two good colonies in the stock plate | ||
| + | which we then send for sequencing | ||
| + | |||
| + | We take the four tubes from tuesday, and take 150ml of that twice, spin down, etc. | ||
| + | |||
| + | ==13:26, 16 April 2013 (EDT)== | ||
| + | |||
| + | Golden Gate Protocol | ||
| + | |||
| + | 3.5uL water | ||
| + | 1uL Ligase Buffer | ||
| + | 0.5uL Ligase | ||
| + | 0.5uL BsmBI | ||
| + | 1uL each Construct | ||
| + | 0.5uL Vector | ||
Current revision
Contents |
Beginning
Construction File PCA1 quic-1 oligo (1-16) (455 bp, quiC-0) PCA2 quic-1 oligo (14/16) (455 bp, quic1) Digest quic-1 (EcoRI/BamHI 410+26+19, L, quicCdig) Digest pBca9145-1144#5 (EcoRI/ BamHI, 2057+910, L, vectdig) Ligate quic-1dig+vectdig (pCWM001) >quiC-1 GCATCGTCTCATCGGTCTCCTATGATGAAATTAACCTCTTTAAGGGTATCTTTGTTGGCCTTGGGTTTAGTTACATCAGGTTTCGCCGCCGCTGAAACCTATACTGTAGATAGATATCAAGACGACTCAGAGAAGGGATCTTTAAGATGGGCCATCGAACAGTCAAATGCCAACTCAGCTCAAGAAAACCAAATTTTGATCCAAGCTGTTGGTAAGGCACCTTACGTCATCAAAGTTGATAAACCATTACCTCCTATCAAATCTTCTGTTAAGATTATAGGTACTGAATGGGACAAAACAGGTGAGTTTATAGCCATTGATGGTTCTAACTATATCAAAGGAGAAGGTGAGAAAGCTTGTCCAGGAGCCAACCCTGGACAATACTGAGACGGCAT >pCWM001 aggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcatgagatctGcatcgtctcatcggtctccTATGATGAAATTAACCTCTTTAAGGGTATCTTTGTTGGCCTTGGGTTTAGTTACATCAGGTTTCGCCGCCGCTGAAACCTATACTGTAGATAGATATCAAGACGACTCAGAGAAGGGATCTTTAAGATGGGCCATCGAACAGTCAAATGCCAACTCAGCTCAAGAAAACCAAATTTTGATCCAAGCTGTTGGTAAGGCACCTTACGTCATCAAAGTTGATAAACCATTACCTCCTATCAAATCttctgttaagattataggtactgaatgggacaaaacaggtgagtttatagccaTTGATGGTTCTAACTATATCAAAGGAGAAGGTGAGAAAGCTTGTCCAGGAGCCAACCCTGGACAATACTGAGACGGCATggatcCtaaCTCGAGctgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccacaggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaat Protocol: 1. 38 uL ddH2O 2. 5 ul 10x expand buffer 3. 5 ul 2mM dNTPs 4. 1 ul oligo mixture (100uM total, mixture of oligos after combination of 100uM stocks) 5. 0.75 ul Expand polymerase Program (can run JCA/PCA1) 1. 2 min initial denature at 94oC 2. 30 sec denature at 94oC 3. 30 sec anneal at 55oC [This should be the overlap temp of your oligos - vary as needed] 4. 30 sec extension at 72oC 5. repeat 2-4 30 times total
Did the PCA on Friday
On monday the 12th started by doing the following
Conrad McKinnon 13:09, 12 March 2013 (EDT)
Regular Zymo Cleanup
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.
Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. (surprisingly this fit) Transfer into the Zymo column (small clear guys) (this was the tube within a tube) spin through, discard waste. (for 60-90seconds) Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) spin through, discard waste. Add 200 uL of Zymo Wash Buffer spin through, discard waste. spin for 90 seconds, full speed to dry. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
Then do PCA2
1 ul each outer oligo (10 uM) 1 ul purified pca product .5 ul phusion 10 ul 5x phusion buffer 5 ul 2mM dNTPs 32.5 ul H2O
Conrad McKinnon 12:53, 19 March 2013 (EDT)
First do a zymo clean up
The following procedure removes the polymerase, dNTPs, buffer, and most of the oligonucleotides from a PCR reaction. It also will remove the buffer and restriction enzymes from a restriction digest reaction.
Add 180 uL of Zymo ADB buffer (brown bottle) to a 33uL or 50uL reaction. Transfer into the Zymo column (small clear guys) spin through, discard waste. Add 200 uL of Zymo Wash Buffer (which is basically 70% ethanol) spin through, discard waste. Add 200 uL of Zymo Wash Buffer spin through, discard waste. spin for 90 seconds, full speed to dry. elute with water into a fresh Eppendorf tube, use the same volume of water as the volume of the original reaction
then and eco/bamh1 digestion
Conrad McKinnon 12:42, 21 March 2013 (EDT)
So everything failed horribly and in a fire. Luckily for all those involved chris saved everything and created a perfect quic-1 digest.
Now for today, we are going to do:
Ligation of EcoRI/BamHI digests http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 Transformation http://openwetware.org/wiki/Template:SBB-Protocols_Micro1
Conrad McKinnon 17:05, 2 April 2013 (EDT)
So almost all the colonies failed to grow, with only two of them succeeding. Both happened to be the end step of a compound and used EcoR/BglII to cut as opposed to BamH1 and BglII. Interesting
Anyways the job to do was to go back and redigest everything and then run a gel to confirm that we actually had something. I had something, which is good because chris had done the whole thing because my was fucked up to begin with so if nothing was there major problems.
Anyways on thursday we are going to ligate and transform them into bacteria again and see what shakes out. hopefully it works this time
Conrad McKinnon 12:48, 9 April 2013 (EDT)
Got back the bacteria plates. My plate has around 10 colonies on it. We will now pick four and label four tubes.
Conrad McKinnon 13:48, 11 April 2013 (EDT)
The overall plan is as follows.
- . 1. Miniprep our colonies.
http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 note, we didn't clean up, we are gel purifying.
- . 2. restriction map with EcoR1/Xho1
made a mastermix with
- 30 ul water
- 5 ul buffer
- 2.5 Xho1
- 2.5 EcoR1
then add 7.5 ul of this to each tube with 2 ul of DNA in it
- . 3. We then run a gel
- . 4. Then we put all the juice from two good colonies in the stock plate
which we then send for sequencing
We take the four tubes from tuesday, and take 150ml of that twice, spin down, etc.
13:26, 16 April 2013 (EDT)
Golden Gate Protocol
3.5uL water 1uL Ligase Buffer 0.5uL Ligase 0.5uL BsmBI 1uL each Construct 0.5uL Vector



