User contributions

From OpenWetWare

(Latest | Earliest) View (newer 500) (older 500) (20 | 50 | 100 | 250 | 500)

• 20:42, 20 March 2013 (hist) (diff) m TAE‎ (top)
• 20:42, 20 March 2013 (hist) (diff) m Silver: 50x TAE‎ (top)
• 20:42, 20 March 2013 (hist) (diff) m SDS sample buffer‎
• 20:42, 20 March 2013 (hist) (diff) m S30 buffer‎ (top)
• 20:42, 20 March 2013 (hist) (diff) m Koch Lab:Protocols/Kinesin/BRB80 Acid Pipes‎ (top)
• 20:41, 20 March 2013 (hist) (diff) m Kafatos:P3‎ (top)
• 20:41, 20 March 2013 (hist) (diff) m Kafatos:P2‎ (top)
• 20:41, 20 March 2013 (hist) (diff) m Kafatos:P1‎ (top)
• 20:41, 20 March 2013 (hist) (diff) m Kafatos:10x PBS‎ (top)
• 20:40, 20 March 2013 (hist) (diff) m Destain‎ (top)
• 20:39, 20 March 2013 (hist) (diff) m Category:Buffer‎ (Redirecting to Category:Buffers) (top)
• 20:38, 20 March 2013 (hist) (diff) m TAE‎ (→See also)
• 20:35, 20 March 2013 (hist) (diff) m DNA Gel extraction‎ (top)
• 20:11, 20 March 2013 (hist) (diff) Nm Pfx50‎ (New page: ==Description== Fusion of a Thermococcus zilligii polymerase with an accessory protein. Contains proofreading 3'->5' exonuclease activity. Accesory protein stabilizes primer-template comp...) (top)
• 19:52, 20 March 2013 (hist) (diff) m Swartz:Papers‎ (top)
• 02:51, 25 February 2013 (hist) (diff) m Swartz:Protocols/Purification of His-tagged proteins‎ (top)
• 02:45, 25 February 2013 (hist) (diff) m Purification of His-tagged proteins‎ (top)
• 20:30, 11 January 2013 (hist) (diff) m Swartz:Papers‎ (→2012)
• 19:10, 12 November 2012 (hist) (diff) m Swartz:Papers‎ (→2004)
• 16:52, 12 November 2012 (hist) (diff) m Swartz:Papers‎
• 16:57, 12 October 2012 (hist) (diff) m Swartz:Protocols‎ (→Protocols) (top)
• 05:50, 27 September 2012 (hist) (diff) m User:Christopher C VanLang‎ (top)
• 05:49, 27 September 2012 (hist) (diff) m User:Christopher C VanLang‎
• 05:41, 27 September 2012 (hist) (diff) m User:Christopher C VanLang‎
• 05:39, 27 September 2012 (hist) (diff) m User:Christopher C VanLang‎
• 05:38, 27 September 2012 (hist) (diff) m User:Christopher C VanLang‎
• 03:50, 17 September 2012 (hist) (diff) m Qiagen Buffers‎ (→Formulas for Qiagen Kit Buffers) (top)
• 16:36, 24 July 2012 (hist) (diff) Swartz:Protocols/Ribosome purification‎ (top)
• 22:10, 6 July 2012 (hist) (diff) m TBE‎ (→Purpose) (top)
• 22:09, 6 July 2012 (hist) (diff) m TBE‎
• 22:07, 6 July 2012 (hist) (diff) m TBE‎
• 06:53, 1 July 2012 (hist) (diff) m Synthetic Biology:Vectors/pSB**5 design‎ (→Additional features) (top)
• 06:53, 1 July 2012 (hist) (diff) m Synthetic Biology:Vectors/pSB**5 design‎ (→Additional features)
• 06:52, 1 July 2012 (hist) (diff) Nm Category:Vectors‎ (New page: See Vectors) (top)
• 06:51, 1 July 2012 (hist) (diff) m PSC101‎ (top)
• 06:51, 1 July 2012 (hist) (diff) m Escherichia coli/Vectors‎ (→See also)
• 06:48, 1 July 2012 (hist) (diff) m Ethanol precipitation of nucleic acids‎ (→Source Code) (top)
• 06:48, 1 July 2012 (hist) (diff) m Category:PCR‎ (top)
• 06:41, 1 July 2012 (hist) (diff) m DNA ligation‎ (→Specific protocols) (top)
• 06:39, 1 July 2012 (hist) (diff) m Colony PCR‎ (top)
• 04:46, 1 July 2012 (hist) (diff) m Gibson Assembly‎ (top)
• 04:42, 1 July 2012 (hist) (diff) Nm YNB media‎ (New page: ==Summary== *Yeast Nitrogen Base (YNB) ===Yeast Nitrogen Base (YNB), per liter=== * Biotin 2 μg * Calcium pantothenate 400 μg * Folic acid 2 μg * Inositol 2000 μg * Niacin 40...) (top)
• 03:35, 1 July 2012 (hist) (diff) m Swartz:Protocols‎
• 05:03, 28 June 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 05:02, 28 June 2012 (hist) (diff) Nm S30 buffer‎ (New page: =S30 Buffer= ==Purpose== Used for cell free extract prep ==Preparation== ====To make 1 L of 100x stock==== *1M Tris-Acetate pH 8.2 **121.14 g Trizma Base (Sigma T6066) **Adjust with Glac...)
• 04:55, 28 June 2012 (hist) (diff) m Media‎ (Redirecting to Category:Media) (top)
• 04:53, 28 June 2012 (hist) (diff) Nm YT‎ (New page: == Summary == 2x YT Medium. == Ingredients == ===For 1000 ml=== *10g Bacto yeast extract *16g Bacto Tryptone *5g NaCl Adjust to pH 7.0 prior to use. ==Extended instructions== *combine:...) (top)
• 04:47, 28 June 2012 (hist) (diff) Nm Genomic DNA Extraction‎ (New page: =Bacterial Genomic DNA Extraction= ==Protocol== #Culture 5 ml of the bacteria strain in LB medium until stationary phase (overnight) #Centrifuge 2 ml of culture 10 min at room temperature...) (top)
• 04:46, 28 June 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 04:40, 28 June 2012 (hist) (diff) m Swartz:Protocols/Protein gels‎ (top)
• 04:38, 28 June 2012 (hist) (diff) m Making a long term stock of bacteria‎ (→Method) (top)
• 04:34, 28 June 2012 (hist) (diff) Making a long term stock of bacteria‎ (→Notes)
• 04:34, 28 June 2012 (hist) (diff) m Making a long term stock of bacteria‎
• 04:30, 28 June 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 04:26, 28 June 2012 (hist) (diff) N Swartz:Protocols/Protein gels‎ (New page: https://docs.google.com/document/d/11R2lvr_NIa2uSuxqNjvPmfPURieiF_ML3YOcAJmnA1M/edit =Running a Protein Gel= ==Protocol== #setup the reaction mixture only 20ul is loaded into the wells,...)
• 04:20, 28 June 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 17:55, 25 June 2012 (hist) (diff) m Free Sulfhydryl Determination‎ (→Reagents) (top)
• 17:54, 25 June 2012 (hist) (diff) m Free Sulfhydryl Determination‎
• 17:36, 25 June 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 15:01, 25 June 2012 (hist) (diff) Swartz:People‎ (→Alumni)
• 14:57, 25 June 2012 (hist) (diff) m Swartz:Internal‎ (→Connecting to Datadisk)
• 18:44, 29 May 2012 (hist) (diff) m Swartz:Protocols/otDNA‎ (top)
• 18:44, 29 May 2012 (hist) (diff) m Swartz:Protocols/otDNA‎
• 18:44, 29 May 2012 (hist) (diff) N Swartz:Protocols/otDNA‎ (New page: HH-otDNA: GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''GCT'''GGTTCAAATCCG'''GCC'''CGCCGGACCA'' HH-...)
• 18:38, 29 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 19:54, 28 May 2012 (hist) (diff) m Swartz:Protocols/HD Extract Prep‎ (top)
• 19:54, 28 May 2012 (hist) (diff) m Swartz:Protocols/1L extract prep‎ (top)
• 19:53, 28 May 2012 (hist) (diff) m Swartz:Protocols/Linear DNA Template‎ (top)
• 19:53, 28 May 2012 (hist) (diff) Nm Category:Cell Free‎ (New page: Cell free protein synthesis) (top)
• 19:52, 28 May 2012 (hist) (diff) m Swartz:Protocols/Cell Free‎ (top)
• 19:47, 28 May 2012 (hist) (diff) m Swartz:Protocols/Cell Free‎
• 19:47, 28 May 2012 (hist) (diff) m Swartz:Protocols/1L extract prep‎
• 19:46, 28 May 2012 (hist) (diff) m Swartz:Protocols/Maxiprep‎ (top)
• 19:46, 28 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 19:46, 28 May 2012 (hist) (diff) m Swartz:Protocols/Column Regeneration‎ (top)
• 19:46, 28 May 2012 (hist) (diff) m Swartz:Protocols/Quikchange‎ (top)
• 19:45, 28 May 2012 (hist) (diff) m Swartz:Protocols/Restriction Cloning‎ (top)
• 19:45, 28 May 2012 (hist) (diff) m Swartz:Protocols/Primer Design‎ (top)
• 19:44, 28 May 2012 (hist) (diff) m Swartz:Protocols/Linear DNA Template‎
• 19:44, 28 May 2012 (hist) (diff) Nm Category:Swartz Protocols‎ (New page: Swartz:Protocols) (top)
• 19:43, 28 May 2012 (hist) (diff) m Swartz:Protocols‎
• 02:14, 25 May 2012 (hist) (diff) m TissueCulture:Thawing cells‎ (top)
• 02:08, 25 May 2012 (hist) (diff) N Thawing cells‎ (Thawing cells moved to TissueCulture:Thawing cells) (top)
• 02:08, 25 May 2012 (hist) (diff) m TissueCulture:Thawing cells‎ (Thawing cells moved to TissueCulture:Thawing cells)
• 02:08, 25 May 2012 (hist) (diff) Nm TissueCulture:Thawing cells‎ (New page: ==Overview== This short protocol describes how to freeze down and thaw (or bring up) mammalian cells (e.g. HeLa, KEK293, CHO, Jurkat T cells). ==Materials== List reagents, supplies and e...)
• 16:39, 18 May 2012 (hist) (diff) m Swartz:Papers‎
• 21:18, 15 May 2012 (hist) (diff) m Swartz:Protocols/Maxiprep‎
• 21:18, 15 May 2012 (hist) (diff) m Miniprep‎ (top)
• 21:17, 15 May 2012 (hist) (diff) N TENS miniprep‎ (TENS miniprep moved to Miniprep/TENS miniprep) (top)
• 21:17, 15 May 2012 (hist) (diff) m Miniprep/TENS miniprep‎ (TENS miniprep moved to Miniprep/TENS miniprep) (top)
• 21:16, 15 May 2012 (hist) (diff) m Miniprep/TENS miniprep‎
• 21:15, 15 May 2012 (hist) (diff) m Miniprep‎
• 21:13, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 21:11, 15 May 2012 (hist) (diff) m Swartz:Protocols/Restriction Cloning‎ (→Ligation and Transformation:)
• 20:01, 15 May 2012 (hist) (diff) m Swartz:Protocols/HD Extract Prep‎
• 20:01, 15 May 2012 (hist) (diff) m Swartz:Protocols/HD Extract Prep‎
• 20:00, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/HD Extract Prep‎ (New page: See Image:Swartz_Lab_Extract_Protocol.pdf)
• 20:00, 15 May 2012 (hist) (diff) N Image:Swartz Lab Extract Protocol.pdf‎ (Swartz Lab Extract Protocol) (top)
• 19:59, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 03:30, 15 May 2012 (hist) (diff) m Swartz:Protocols‎
• 03:16, 15 May 2012 (hist) (diff) m Swartz:Protocols/Purification of His-tagged proteins‎
• 03:15, 15 May 2012 (hist) (diff) m Swartz:Protocols/Purification of His-tagged proteins‎
• 03:13, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/A20 cells‎ (New page: : Hey Kedar, : : No problem. For the freezing cell protocol it is pretty simple. First make : sure the cells are crowded but very healthy before freezing. Make a : 10%DMSO solution from ...) (top)
• 03:12, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Miscellaneous)
• 03:01, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/HPLC‎ (New page: https://docs.google.com/document/d/1u-pF8-jbFt8zLzd3oW01XVPn4mkQ400ldB_muA2qObs/edit =HPLC guide= :The HPLC on the right uses the older Windows interface; left uses newer Windows :.M fil...) (top)
• 03:00, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 03:00, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/Linear DNA Template‎ (New page: See https://docs.google.com/document/d/1SImrjVvULhFQleGOoGGey4uJGKkJOxN0xnTy_QnqI8Q/edit =Linear DNA templates for coupled transcription-translation= ==Reagents== :Primers ::Gene-specifi...)
• 02:58, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 02:55, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/Ribosome binding‎ (New page: https://docs.google.com/document/d/1DMFYbh9e4B85gzzhhFq6KnLiRk2tiiH2kWoL_fBtgNA/edit) (top)
• 02:55, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 02:53, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/Ribosome purification‎ (New page: See https://docs.google.com/document/d/1NIr0ldJ3qRHlnsK1kKO-WOEMJor2i8oIsP89cbREMxE/edit =Ribosome Purification= Buffers: BME should be added just before use -it may be helpful to make ...)
• 02:51, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Protein Purification)
• 02:50, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/Mass spec‎ (New page: https://docs.google.com/document/d/1dM7bkfLRV6W1vNYTUsNuWry2B430t9VJWAHxQMWsKqw/edit Proteins in polyacrylamide gel *Samples for protein identification by proteolytic digestion and LC-MS...) (top)
• 02:49, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 02:48, 15 May 2012 (hist) (diff) m Swartz:Protocols/Restriction Cloning‎
• 02:44, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/1L extract prep‎ (New page: https://docs.google.com/document/d/1KdksMWFTIV8TRWiV7-AOcve_uCsxq2f6B5__DB-s9fI/edit ==1L shake flask extract prep:== S30 buffer: ===Cell prep:=== *Add single colony or glycerol stock ...)
• 02:43, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 02:33, 15 May 2012 (hist) (diff) m Swartz:Protocols/Maxiprep‎
• 02:30, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/Buffers‎ (New page: To make own buffers for frequent cloning, these are the recipes: :Buffer P1 (resuspension): ::50 mM Tris·Cl, pH 8.0 ::10 mM EDTA ::100 µg/ml RNase A :Buffer P2 (Lysis) :: 200 mM NaOH ...) (top)
• 02:29, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 02:28, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Assays)
• 02:27, 15 May 2012 (hist) (diff) Nm Swartz:Protocols/Primer Design‎ (New page: See this for now. https://docs.google.com/document/edit?id=1Ds8NCJau5nYv44mlO9NafPd8k25h8c4Hy8Sh2a-WQ5M&hl=en&authkey=CNL2l-IC&pli=1#)
• 02:25, 15 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 20:07, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Purification of His-tagged proteins‎ (New page: See Purification_of_His-tagged_proteins and https://docs.google.com/document/d/1OqY94AYARJD84spfuFVZ_YX1Ypa-i717sxUUJU2GJ9Y/edit)
• 20:07, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Protocols)
• 20:06, 11 May 2012 (hist) (diff) m Swartz:Protocols/Western‎ (top)
• 20:05, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Western‎ (New page: See [Western]] and https://docs.google.com/document/d/1QVxpBKI90ZHogxGM6nP8nPr7fhOhW8vyJ3yAi9dU9uc/edit)
• 20:05, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 20:03, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Column Regeneration‎ (New page: https://docs.google.com/document/d/19E-F4kt27GzKnOS9kxA2BqQl6a7mDHYxDjyiQtsPrno/edit ==Recycling Qiagen Columns== :From Qiagen Buffers The blue and purple Qiagen columns are identica...)
• 20:02, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 20:00, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Autoradiogram‎ (New page: https://docs.google.com/document/d/1vgVufOvnKvn84drFBmOtEqhZQEKNFzKqw82ItypqvHI/edit ==How to do an Autoradiogram== :Kurt Knapp :10/25/04 :Uploaded by Chris VanLang 9/21/11 ===Drying the...) (top)
• 19:58, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 19:57, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Gel purification‎ (New page: https://docs.google.com/document/d/17lf6hG6u25vGYEW3y1CxoGyKHr-yJv9LbZeoYSGOw04/edit) (top)
• 19:57, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 19:56, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Quikchange‎ (New page: See https://docs.google.com/document/d/1Z65LmK7fOUqnJ8_0A9xrUi-AUN2Vfru8VYR9WoLS_YM/edit or Site-directed_mutagenesis)
• 19:55, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 19:54, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 19:53, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/Restriction Cloning‎ (New page: currently this page https://docs.google.com/document/d/1msML32vGmNI5klFypOuzPOZh5yB5MlatP7IZytZF1lQ/edit)
• 19:52, 11 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 19:49, 11 May 2012 (hist) (diff) Nm Swartz:Protocols/PCR‎ (New page: ==PCR== PCR: [Cem] *Minimize freeze-thaw cycles (3 max) on dNTP stock solution. 10 ul working aliquots and 50 / 100 ul storage solutions worked well for me. *Volume of the reaction soluti...) (top)
• 15:34, 5 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 15:34, 5 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 15:33, 5 May 2012 (hist) (diff) Nm Swartz:Protocols/Maxiprep‎ (New page: https://docs.google.com/document/d/1woT8L647962azzQERKb_4_GdmsoBTWKpRtyVVSj2OTE/edit Qiagen DNA plasmid MaxiPrep Day 1: Inoculate 5 mL of selective LB broth from glycerol stock or plate ...)
• 15:31, 5 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 15:31, 5 May 2012 (hist) (diff) Nm Swartz:Protocols/Cell Free‎ (New page: https://docs.google.com/document/d/1PVxGVnLibUXHoWzrOPR8Sx9j6kVNHJnpLg15NIx5Wx0/edit =Cell-free reactions= 4 September 2006 – John Welsh ==Pre-mix prep:== *Thaw reagents on ice. * Calc...)
• 15:27, 5 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 15:26, 5 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cell Free Protein Synthesis)
• 15:24, 5 May 2012 (hist) (diff) m Swartz:Protocols‎ (→Cloning)
• 15:20, 5 May 2012 (hist) (diff) m Swartz:Protocols‎
• 15:17, 5 May 2012 (hist) (diff) m Swartz:People‎ (→Alumni)
• 02:25, 17 April 2012 (hist) (diff) m User:Christopher C VanLang‎ (→Publications)
• 02:24, 17 April 2012 (hist) (diff) m User:Christopher C VanLang‎ (→Publications)
• 02:23, 17 April 2012 (hist) (diff) m User:Christopher C VanLang‎ (→Useful Links)
• 02:23, 17 April 2012 (hist) (diff) m User:Christopher C VanLang‎ (→Christopher VanLang)
• 21:46, 17 February 2012 (hist) (diff) Nm TissueCulture:splitting cells‎ (New page: ==Concept== Tissue culture cells need to be "split" to keep them alive. The process involves taking a portion of the cells and resuspending them in fresh culture media so they can grow. I...) (top)
• 21:03, 12 January 2012 (hist) (diff) m Cloning‎ (→Transformation) (top)
• 21:02, 12 January 2012 (hist) (diff) m Cloning‎ (→Ligation)
• 21:02, 12 January 2012 (hist) (diff) m Cloning‎ (→Materials)
• 21:01, 12 January 2012 (hist) (diff) m Cloning‎
• 20:59, 12 January 2012 (hist) (diff) m Cloning‎
• 20:58, 12 January 2012 (hist) (diff) m Cloning‎ (→Procedure)
• 05:58, 10 January 2012 (hist) (diff) m MOPS‎ (top)
• 02:44, 5 January 2012 (hist) (diff) m Carbenicillin‎ (→Plasmid stabilization) (top)
• 23:10, 1 January 2012 (hist) (diff) m DNA ligation‎ (→Notes)
• 22:50, 1 January 2012 (hist) (diff) m Carbenicillin‎
• 23:52, 29 December 2011 (hist) (diff) m Cloning‎ (→Specific Protocols)
• 23:52, 29 December 2011 (hist) (diff) m Cloning‎ (→Procedure)
• 23:49, 29 December 2011 (hist) (diff) Nm Rutgers:Big Dye Sequencing‎ (New page: === Big dye sequencing reaction === 4.1- Equipment *PCR machine 4.2- Reagents 4.3- Other consumables 4.4- Procedure *All the following steps must be made on ice *Prepare the following m...) (top)
• 23:48, 29 December 2011 (hist) (diff) m Sequencing DNA‎ (→Specific Protocols) (top)
• 23:46, 29 December 2011 (hist) (diff) m Molecular Cloning‎ (top)
• 23:45, 29 December 2011 (hist) (diff) m Bacterial transformation‎ (→Introduction) (top)
• 23:40, 29 December 2011 (hist) (diff) Nm Rutgers:Transformation‎ (New page: Bacterial transformation(IMPORTANT: keep the cc on ice as much as possible) *set a heating block at 42°C and fill wells with DW *defrost a 2 ml tube of SOC medium *place the required ...) (top)
• 23:40, 29 December 2011 (hist) (diff) Nm Rutgers:DNA Ligation‎ (New page: *Prepare a master-mix in a 0.5 ml tube containing (µl): DW Tp2x pGEMT Ligase - for 1 tube: 1.5 2.5 0.25 0.5 (total: 4.75) - for 4 tubes: 6.0 10.0 1.0 2.0 (total: 19.0)...) (top)
• 23:15, 29 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 23:14, 29 December 2011 (hist) (diff) m Cloning Protocol‎ (→PCR) (top)
• 23:13, 29 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 23:12, 29 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 23:12, 29 December 2011 (hist) (diff) m SOB‎ (top)
• 23:09, 29 December 2011 (hist) (diff) m SOC‎ (→Protocol)
• 23:08, 29 December 2011 (hist) (diff) m SOC‎ (→Protocol)
• 23:06, 29 December 2011 (hist) (diff) m SOC‎ (→Protocol)
• 23:05, 29 December 2011 (hist) (diff) m SOC‎ (→Protocol)
• 22:53, 29 December 2011 (hist) (diff) m Wikiomics:PDB‎ (→See also) (top)
• 22:51, 29 December 2011 (hist) (diff) m General Cloning Protocol‎ (top)
• 21:59, 29 December 2011 (hist) (diff) Nm Category:Molecular Viewers‎ (New page: Category:software Category:structure) (top)
• 21:58, 29 December 2011 (hist) (diff) m Category:Structure‎ (top)
• 21:57, 29 December 2011 (hist) (diff) m Category:Purification‎ (top)
• 21:56, 29 December 2011 (hist) (diff) Nm Category:Purification‎ (New page: Section for the purification of macromolecules ==Protocols== ===General=== {{#dpl:category=Purification|category=Protocol|nottitlematch=%:%}} ===Lab-specific protocols=== {{#dpl:category...)
• 21:55, 29 December 2011 (hist) (diff) m Purification of DNA‎ (→See also) (top)
• 21:55, 29 December 2011 (hist) (diff) m Protein purification tags‎ (top)
• 21:54, 29 December 2011 (hist) (diff) ISISBio:Protocols/Purification/Tus‎ (top)
• 21:53, 29 December 2011 (hist) (diff) m Duffy:LIC Cloning‎ (→Contact) (top)
• 21:52, 29 December 2011 (hist) (diff) N Structure Analysis‎ (Structure Analysis moved to Structure analysis) (top)
• 21:52, 29 December 2011 (hist) (diff) m Structure analysis‎ (Structure Analysis moved to Structure analysis) (top)
• 21:51, 29 December 2011 (hist) (diff) m Protocols‎ (→In silico)
• 21:50, 29 December 2011 (hist) (diff) m Coot and WinCoot for X-ray Crystallography Model Building‎ (→Contact) (top)
• 21:47, 29 December 2011 (hist) (diff) m Jhdavis::Useful pymol‎ (top)
• 21:46, 29 December 2011 (hist) (diff) m Gene Construction Kit software review‎ (top)
• 21:46, 29 December 2011 (hist) (diff) m Cloning‎ (→See Also)
• 21:45, 29 December 2011 (hist) (diff) m ApE - A Plasmid Editor (software review)‎
• 21:44, 29 December 2011 (hist) (diff) m General Cloning Protocol‎
• 21:44, 29 December 2011 (hist) (diff) m Duffy:LIC Cloning‎
• 21:44, 29 December 2011 (hist) (diff) m Gateway cloning system‎ (top)
• 21:43, 29 December 2011 (hist) (diff) m Gateway cloning system‎
• 21:43, 29 December 2011 (hist) (diff) m Cloning‎ (→Specific Protocols)
• 21:41, 29 December 2011 (hist) (diff) m Knight:TOPO TA cloning‎ (→Patents) (top)
• 21:41, 29 December 2011 (hist) (diff) m Cloning‎ (→See Also)
• 21:39, 29 December 2011 (hist) (diff) m Structure analysis‎
• 21:39, 29 December 2011 (hist) (diff) m Wikiomics:Docking toolbox‎ (top)
• 21:37, 29 December 2011 (hist) (diff) m Wikiomics:Docking toolbox‎
• 21:34, 29 December 2011 (hist) (diff) m Structure analysis‎ (→See Also)
• 21:33, 29 December 2011 (hist) (diff) m Structure analysis‎
• 21:31, 29 December 2011 (hist) (diff) m Structure analysis‎
• 21:08, 29 December 2011 (hist) (diff) m Structure analysis‎
• 21:07, 29 December 2011 (hist) (diff) Nm Structure analysis‎ (New page: Section for structure analysis of macromolecules Category:Structure analysis)
• 21:00, 29 December 2011 (hist) (diff) N User talk:Christopher C Vanlang‎ (User talk:Christopher C Vanlang moved to User talk:Christopher C VanLang: That's my name) (top)
• 21:00, 29 December 2011 (hist) (diff) N User:Christopher C Vanlang/presentations‎ (User:Christopher C Vanlang/presentations moved to User:Christopher C VanLang/presentations: That's my name) (top)
• 21:00, 29 December 2011 (hist) (diff) N User:Christopher C Vanlang‎ (User:Christopher C Vanlang moved to User:Christopher C VanLang: That's my name) (top)
• 21:00, 29 December 2011 (hist) (diff) m User:Christopher C VanLang/presentations‎ (User:Christopher C Vanlang/presentations moved to User:Christopher C VanLang/presentations: That's my name) (top)
• 21:00, 29 December 2011 (hist) (diff) m User talk:Christopher C VanLang‎ (User talk:Christopher C Vanlang moved to User talk:Christopher C VanLang: That's my name) (top)
• 21:00, 29 December 2011 (hist) (diff) m User:Christopher C VanLang‎ (User:Christopher C Vanlang moved to User:Christopher C VanLang: That's my name)
• 21:12, 28 December 2011 (hist) (diff) m Site-directed mutagenesis‎ (→Manuals)
• 21:09, 28 December 2011 (hist) (diff) m Site-directed mutagenesis‎ (→References)
• 17:57, 23 December 2011 (hist) (diff) m Protocols/Pouring plates‎ (→Notes) (top)
• 17:54, 23 December 2011 (hist) (diff) m Protocols/Pouring plates‎ (→Pouring Plates)
• 17:51, 23 December 2011 (hist) (diff) m Protocols/Pouring plates‎ (→Pouring Plates)
• 17:49, 23 December 2011 (hist) (diff) m Protocols/Pouring plates‎ (→Procedure)
• 17:49, 23 December 2011 (hist) (diff) m Protocols/Pouring plates‎ (→Materials)
• 17:47, 23 December 2011 (hist) (diff) Nm Protocols/Pouring plates‎ (New page: ==Abstract== You need plates. Time to pour some. ==Materials== List everything necessary to perform the protocol here. Include all information about suppliers, ordering details, etc. Lin...)
• 17:35, 23 December 2011 (hist) (diff) m Cloning‎ (→PCR products cloning)
• 17:33, 23 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 17:33, 23 December 2011 (hist) (diff) Nm DYT‎ (New page: 1.7- DYT medium For 500 mL * 8.0 g tryptone * 5.0 g yeast extract * 2.5 g NaCl For 100 mL * 1.6 g tryptone * 1.0 g yeast extract * 0.5 g NaCl *mix in DW *add 10 N NaOH (about 2.5 drops...) (top)
• 17:27, 23 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 17:26, 23 December 2011 (hist) (diff) m IPTG‎ (top)
• 17:25, 23 December 2011 (hist) (diff) m IPTG‎
• 17:23, 23 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 17:23, 23 December 2011 (hist) (diff) m LB‎ (→Protocol) (top)
• 17:22, 23 December 2011 (hist) (diff) m X-Gal‎ (top)
• 17:18, 23 December 2011 (hist) (diff) m LB‎ (→Ingredients)
• 17:16, 23 December 2011 (hist) (diff) m LB‎ (→Protocol)
• 17:10, 23 December 2011 (hist) (diff) m Assembly pcr‎ (top)
• 17:08, 23 December 2011 (hist) (diff) m Swartz:Papers‎ (→2004)
• 17:08, 23 December 2011 (hist) (diff) m Swartz:Papers‎ (→2004)
• 17:07, 23 December 2011 (hist) (diff) m Swartz:Papers‎ (→2004)
• 17:06, 23 December 2011 (hist) (diff) m Swartz:Papers‎ (→2004)
• 17:04, 23 December 2011 (hist) (diff) m Swartz:Papers‎ (→2004)
• 17:03, 23 December 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Publications)
• 17:02, 23 December 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Publications)
• 17:01, 23 December 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Presentations)
• 06:52, 22 December 2011 (hist) (diff) m Materials‎ (→Buffers)
• 06:52, 22 December 2011 (hist) (diff) m Materials‎ (→Buffers)
• 06:51, 22 December 2011 (hist) (diff) m Materials‎ (→Buffers)
• 06:49, 22 December 2011 (hist) (diff) m T4 DNA ligase‎ (top)
• 06:30, 22 December 2011 (hist) (diff) m NanoBio: PCR‎ (top)
• 06:30, 22 December 2011 (hist) (diff) m PCR Overlap Extension‎ (top)
• 06:30, 22 December 2011 (hist) (diff) m PCR techniques‎ (top)
• 06:29, 22 December 2011 (hist) (diff) Nm Category:PCR‎ (New page: Category:In_vitro)
• 06:29, 22 December 2011 (hist) (diff) m PCR‎ (→See also) (top)
• 06:27, 22 December 2011 (hist) (diff) m Competent cells‎ (→Making Competent Cells) (top)
• 06:27, 22 December 2011 (hist) (diff) Nm Competent cells‎ (New page: ==Background== Competence is the ability for cells to take up naked DNA from their surroundings. This ability is key for the uptake of new genes. ==Protocols== ===Making Competent Cells==...)
• 06:20, 22 December 2011 (hist) (diff) m Cloning‎ (→Specific Protocols)
• 06:20, 22 December 2011 (hist) (diff) m Cloning Protocol‎
• 06:19, 22 December 2011 (hist) (diff) m Cloning and sequencing‎ (top)
• 06:18, 22 December 2011 (hist) (diff) m Cloning Checklist‎ (top)
• 06:18, 22 December 2011 (hist) (diff) m Cloning‎ (→Specific Protocols)
• 06:15, 22 December 2011 (hist) (diff) m Cloning‎ (→PCR products cloning)
• 06:13, 22 December 2011 (hist) (diff) m Cloning‎ (→Specific Protocols)
• 05:37, 22 December 2011 (hist) (diff) m Purification of DNA‎ (→Alcohol precipitation)
• 05:35, 22 December 2011 (hist) (diff) m Cloning‎ (→Sequencing)
• 05:34, 22 December 2011 (hist) (diff) m DNA Sequencing‎ (top)
• 05:31, 22 December 2011 (hist) (diff) Nm Conklin/DNA Sequencing‎ (New page: *R02-ORF *R03:GFP-tagged RASSL *hKOR-FLAG/HA-pcDNA3 *SS-Flag-GFP-hMC4R *GTX-IRES *Epitope-tagged G Proteins from the ATCC *Gladstone Genomics Core [http://www.g...) (top)
• 05:31, 22 December 2011 (hist) (diff) m Conklin‎ (→Research Tools) (top)
• 05:26, 22 December 2011 (hist) (diff) m Ethanol precipitation of nucleic acids‎ (→96 Well Plate Protocol)
• 05:24, 22 December 2011 (hist) (diff) m Ethanol precipitation of nucleic acids‎ (→96 Well Plate Protocol)
• 05:07, 22 December 2011 (hist) (diff) m Cloning‎ (→Cleaning of the sequencing reaction products by precipitation)
• 05:05, 22 December 2011 (hist) (diff) m Ethanol precipitation of nucleic acids‎ (→Procedure)
• 05:03, 22 December 2011 (hist) (diff) m Ethanol precipitation of nucleic acids‎ (→Material)
• 05:03, 22 December 2011 (hist) (diff) m Ethanol precipitation of nucleic acids‎ (→Material)
• 05:02, 22 December 2011 (hist) (diff) m Cloning‎ (→Cleaning of the sequencing reaction products by precipitation)
• 04:55, 22 December 2011 (hist) (diff) m Cloning‎
• 04:54, 22 December 2011 (hist) (diff) m Cloning‎ (→Media and plates)
• 04:47, 22 December 2011 (hist) (diff) m Cloning‎
• 04:43, 22 December 2011 (hist) (diff) m Cloning‎
• 04:21, 22 December 2011 (hist) (diff) m Category:Cloning‎ (top)
• 03:58, 8 November 2011 (hist) (diff) m Swartz:Papers‎
• 03:51, 8 November 2011 (hist) (diff) N Image:Swartz wordle.jpg‎ (Wordle for the Swartz Lab) (top)
• 00:04, 28 October 2011 (hist) (diff) m Swartz‎
• 21:50, 7 October 2011 (hist) (diff) m Swartz:Research/VLPs‎ (top)
• 21:49, 7 October 2011 (hist) (diff) m Swartz:Research/VLPs‎
• 21:49, 7 October 2011 (hist) (diff) m Swartz:Research/VLPs‎
• 21:33, 7 October 2011 (hist) (diff) Nm Swartz:Research/VLPs‎ (New page: {{Template:Swartz}} The Virus-Like Particles team in the Swartz Lab focuses on developing Biotechnology-based solutions using VLPs. Using the cell free protein synthesis platfo...)
• 14:14, 26 September 2011 (hist) (diff) m User:Phillip R. Smith‎
• 20:53, 9 August 2011 (hist) (diff) Nm Miniprep/TENS miniprep‎ (New page: {{back to protocols}} ==Background== TENS method of minipreps. Fast but dirty. ==Protocol== #Transfer 1.5 mL of an overnight culture containing your plasmid to an eppendorf tube and spin ...)
• 20:54, 24 June 2011 (hist) (diff) m Swartz:Research‎
• 20:44, 24 June 2011 (hist) (diff) m Swartz:Research‎
• 20:43, 24 June 2011 (hist) (diff) m Swartz:Research‎
• 20:37, 24 June 2011 (hist) (diff) m Swartz:Research‎
• 19:02, 23 June 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Useful Links)
• 19:01, 23 June 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Past Research)
• 19:00, 23 June 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Christopher VanLang)
• 18:59, 23 June 2011 (hist) (diff) m Swartz:Research‎
• 18:57, 23 June 2011 (hist) (diff) m Swartz:Research‎
• 18:54, 22 June 2011 (hist) (diff) m Swartz:Research/Protocols‎
• 18:54, 22 June 2011 (hist) (diff) m Swartz:Research/Protocols‎
• 21:24, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols/Cloning‎
• 19:49, 21 June 2011 (hist) (diff) Nm Swartz:Research/Protocols/Cloning/Plasmids‎ (New page: {{Template:Swartz}} *[https://docs.google.com/leaf?id=0B-Gtz3V56Y9xZmVhOTg3NTEtOTgxMy00MDMxLThjMjMtMDJjOTVhMWVkNzk2&hl=en_US&authkey=CPrR1oQL pY71 vector]) (top)
• 19:44, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols/Cloning‎
• 19:35, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols/Cloning‎ (Replacing page with '{{Template:Swartz}} *Agarose_gel_electrophoresis *PCR *Assembly_pcr *Restriction_Digest *DNA_ligation')
• 19:31, 21 June 2011 (hist) (diff) Nm Swartz:Research/Protocols/Cloning‎ (New page: Confirmation of DNA/RNA synthesis, agarose gels (Old Title: Check DNA or RNA by 4.0% agarose gel Electrophoresis) Das lab, Stanford Biochemistry For more information on protocols, see Da...)
• 19:30, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols‎
• 19:29, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols‎
• 19:28, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols‎
• 19:28, 21 June 2011 (hist) (diff) m Swartz:Research/Protocols‎
• 19:26, 21 June 2011 (hist) (diff) m Swartz:Research‎
• 19:25, 21 June 2011 (hist) (diff) Nm Swartz:Research/Protocols‎ (New page: {{Template:Swartz}})
• 19:25, 21 June 2011 (hist) (diff) m Swartz:Research‎
• 19:23, 21 June 2011 (hist) (diff) m Swartz:Research‎
• 19:23, 21 June 2011 (hist) (diff) m Swartz:Research‎
• 19:22, 21 June 2011 (hist) (diff) m Swartz:People‎ (→Graduate students)
• 19:21, 21 June 2011 (hist) (diff) m Swartz:News‎
• 19:16, 21 June 2011 (hist) (diff) m Swartz:Papers‎
• 19:14, 21 June 2011 (hist) (diff) m Swartz:Papers‎
• 15:30, 13 June 2011 (hist) (diff) m Cloning‎
• 15:29, 13 June 2011 (hist) (diff) m Cloning‎
• 19:30, 21 February 2011 (hist) (diff) m Swartz:News‎
• 05:34, 28 January 2011 (hist) (diff) Labs‎ (→North America)
• 05:33, 28 January 2011 (hist) (diff) Swartz:Papers‎
• 05:32, 28 January 2011 (hist) (diff) m Swartz:Papers‎ (→2010)
• 05:31, 28 January 2011 (hist) (diff) m Swartz:Papers‎ (→2010)
• 05:31, 28 January 2011 (hist) (diff) m Swartz:Papers‎
• 05:29, 28 January 2011 (hist) (diff) m Swartz:Papers‎ (→2010)
• 05:18, 28 January 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Christopher VanLang)
• 05:17, 28 January 2011 (hist) (diff) Swartz:People‎ (→Graduate students)
• 05:16, 28 January 2011 (hist) (diff) m Swartz:Papers‎ (→2010)
• 05:15, 28 January 2011 (hist) (diff) m Swartz:Papers‎ (→2010)
• 15:28, 11 January 2011 (hist) (diff) m User:Christopher C VanLang‎
• 15:28, 11 January 2011 (hist) (diff) m User:Christopher C VanLang‎
• 15:49, 6 January 2011 (hist) (diff) m User:Christopher C VanLang‎ (→Useful Links)
• 18:53, 20 August 2010 (hist) (diff) m Wikiomics:Alignment visualization and plotting RNA structures‎ (→Plotting RNA structures) (top)
• 13:32, 28 June 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/28 June 2010‎ (top)
• 13:31, 28 June 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/28 June 2010‎
• 12:27, 28 June 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/28 June 2010‎
• 12:19, 28 June 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/28 June 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> General Meeting -Transform the first wave of cells --Pick colonies --Colony PCR --Sequence parts to vali...)
• 12:16, 28 June 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes) (top)
• 02:59, 23 May 2010 (hist) (diff) m IGEM:Stanford/2010/Research‎ (→Project) (top)
• 02:59, 23 May 2010 (hist) (diff) m IGEM:Stanford/2010/Research‎ (→Project)
• 19:27, 16 May 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/20 May 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==May 20 2010== <biblio> #Akin pmid=18654330 <biblio> </div>) (top)
• 19:26, 16 May 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/18 May 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==May 18 2010== </div>) (top)
• 19:26, 16 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/11 May 2010‎ (top)
• 19:25, 16 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 17:04, 13 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/13 May 2010‎ (→May 13 2010) (top)
• 17:03, 13 May 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/13 May 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==May 13 2010== Engineering cottonseed for use in human nutrition by tissue-specific reduction of toxic g...)
• 17:01, 13 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/6 May 2010‎ (→April 22 2010) (top)
• 17:01, 13 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/6 May 2010‎
• 16:58, 13 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 16:58, 13 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 01:38, 12 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/11 May 2010‎ (→References brought up during meeting)
• 17:37, 3 May 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/6 May 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==April 22 2010== Emergent Properties of Reduced-Genome Escherichia coli by Posfai et al. <biblio> #Tsien...)
• 17:37, 3 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 18:55, 2 May 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Random Brainstorming)
• 23:24, 29 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/29 April 2010‎ (→April 22 2010) (top)
• 17:42, 29 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/4 May 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==Premise== Hi everyone: Based on last week's meeting, team members are going to be pairing up with gra...)
• 17:40, 29 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 04:15, 27 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/Brainstorming‎ (→Projects)
• 04:07, 26 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/Brainstorming‎ (→Comments)
• 04:07, 26 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/Brainstorming‎ (→Projects)
• 21:02, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/Brainstorming‎
• 21:00, 25 April 2010 (hist) (diff) N Image:Brainstorming-Direction-Poll.pdf‎ (top)
• 20:59, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/Brainstorming‎
• 20:55, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/27 April 2010‎
• 20:54, 25 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/Brainstorming‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> '''Alex Virrueta''' ''Vesicular Transport'' (*) 1. Previous Paris Team wanted to engineer superhighways...)
• 20:52, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Random Brainstorming)
• 20:52, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 20:52, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Random Brainstorming)
• 20:52, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Random Brainstorming)
• 20:51, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Random Brainstorming)
• 20:50, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 01:58, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Reading list‎ (top)
• 01:51, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Reading list‎ (→Reading List)
• 01:44, 25 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/29 April 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==April 22 2010== Molecular breeding of carotenoid biosynthetic pathways by Schmidt-Dannert et al. <bibli...)
• 01:43, 25 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 14:46, 21 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 April 2010‎ (→Comments)
• 14:45, 21 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 April 2010‎ (→Meeting Agenda)
• 14:43, 21 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/27 April 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==Meeting Agenda== ==Meeting Notes== ==Comments== ==Agenda Items for the Next Meeting== </div>)
• 14:43, 21 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 14:42, 21 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 April 2010‎ (→Meeting Notes)
• 05:37, 20 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 05:36, 20 April 2010 (hist) (diff) N IGEM:Stanford/2010/Notebook/16 April 2010‎ (IGEM:Stanford/2010/Notebook/16 April 2010 moved to IGEM:Stanford/2010/Notebook/20 April 2010) (top)
• 05:36, 20 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 April 2010‎ (IGEM:Stanford/2010/Notebook/16 April 2010 moved to IGEM:Stanford/2010/Notebook/20 April 2010)
• 20:12, 16 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎ (→Paper) (top)
• 20:12, 16 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎ (→Paper)
• 20:10, 16 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/22 April 2010‎ (→April 22 2010)
• 20:09, 16 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/15 April 2010‎ (→Journal Club 4/15/10) (top)
• 20:08, 16 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/15 April 2010‎
• 02:33, 15 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 02:32, 15 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 April 2010‎
• 02:32, 15 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/20 April 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==Meeting Agenda== ==Meeting Notes== ==Comments== ==Agenda Items for the Next Meeting==)
• 02:31, 15 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 01:25, 15 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/22 April 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==April 22 2010== Molecular breeding of carotenoid biosynthetic pathways by Schmidt-Dannert et al. <bibli...)
• 01:23, 15 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 19:35, 13 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/15 April 2010‎
• 03:06, 13 April 2010 (hist) (diff) m User:Christopher C VanLang‎ (→Useful Links)
• 18:38, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 18:29, 9 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/15 April 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify">)
• 18:29, 9 April 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/5 April 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify">)
• 18:29, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 18:28, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 18:27, 9 April 2010 (hist) (diff) N IGEM:Stanford/2010/Notebook/6 April 2010‎ (IGEM:Stanford/2010/Notebook/6 April 2010 moved to IGEM:Stanford/2010/Notebook/8 April 2010) (top)
• 18:27, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎ (IGEM:Stanford/2010/Notebook/6 April 2010 moved to IGEM:Stanford/2010/Notebook/8 April 2010)
• 00:21, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 00:19, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 00:18, 9 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 20:48, 8 April 2010 (hist) (diff) m GFP‎
• 20:46, 8 April 2010 (hist) (diff) N Image:GFP structure.png‎ (top)
• 21:10, 7 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 03:40, 6 April 2010 (hist) (diff) N IGEM:Stanford/2010/Notebook/Dynamic March 2010‎ (IGEM:Stanford/2010/Notebook/Dynamic March 2010 moved to IGEM:Stanford/2010/Notebook/6 April 2010)
• 03:40, 6 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎ (IGEM:Stanford/2010/Notebook/Dynamic March 2010 moved to IGEM:Stanford/2010/Notebook/6 April 2010)
• 03:40, 6 April 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 17:20, 31 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 17:18, 31 March 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/31 March 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> </div>)
• 03:34, 31 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 03:34, 31 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/8 April 2010‎
• 03:34, 31 March 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/8 April 2010‎ (New page: Hi Everyone, I hope that the previous reading gave a nice overview of what is the state of the field and that watching the previous iGEM projects will get your minds ticking about what is...)
• 03:32, 31 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 03:30, 31 March 2010 (hist) (diff) m IGEM:Stanford/2010/Reading list‎ (→Reading List)
• 18:14, 24 March 2010 (hist) (diff) m IGEM:Stanford/2010/Reading list‎ (→Reading List)
• 22:31, 3 March 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Graduates‎ (top)
• 22:30, 3 March 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Faculty Advisors‎ (top)
• 22:30, 3 March 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Graduates‎
• 22:30, 3 March 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Undergraduates‎
• 22:29, 3 March 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Graduates‎
• 02:47, 3 March 2010 (hist) (diff) m IGEM:Stanford/2010‎ (→Meeting Notes)
• 18:08, 2 March 2010 (hist) (diff) m Stanford Biochemistry/login‎ (→Are you trying to make edits to this page?) (top)
• 18:07, 2 March 2010 (hist) (diff) Nm Stanford Biochemistry/login‎ (New page: ==Are you trying to make edits to this page? == *Try registering for an account *You will then get a profile like this *You will ...)
• 18:06, 2 March 2010 (hist) (diff) m Stanford Biochemistry‎
• 15:59, 2 March 2010 (hist) (diff) Nm IGEM:Stanford/2010/Reading list‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> <biblio> #smolke4 pmid=11676567 </biblio> </div>)
• 15:57, 2 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Reading Material)
• 15:56, 2 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/25 February 2010‎ (→Action Items) (top)
• 15:55, 2 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/25 February 2010‎ (→Meeting Notes)
• 15:54, 2 March 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/25 February 2010‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> ==Meeting Agenda== *Determine the journal club format and papers *Set up scientific team goals ==Meeting ...)
• 15:48, 2 March 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 20:00, 1 March 2010 (hist) (diff) m User:Christopher C VanLang‎ (→Useful Links)
• 20:00, 1 March 2010 (hist) (diff) m User:Christopher C VanLang‎ (→Christopher VanLang)
• 19:59, 1 March 2010 (hist) (diff) m User:Christopher C VanLang‎ (→Useful Links)
• 17:25, 1 March 2010 (hist) (diff) m Stanford Biochemistry‎
• 17:24, 1 March 2010 (hist) (diff) m Stanford Biochemistry‎
• 17:23, 1 March 2010 (hist) (diff) N /Stanford Biochemistry/Suggestions for Department Website‎ (/Stanford Biochemistry/Suggestions for Department Website moved to Stanford Biochemistry/Suggestions for Department Website) (top)
• 17:23, 1 March 2010 (hist) (diff) m Stanford Biochemistry/Suggestions for Department Website‎ (/Stanford Biochemistry/Suggestions for Department Website moved to Stanford Biochemistry/Suggestions for Department Website)
• 17:23, 1 March 2010 (hist) (diff) N Suggestions for Department Website‎ (Suggestions for Department Website moved to /Stanford Biochemistry/Suggestions for Department Website: reorganizing)
• 17:23, 1 March 2010 (hist) (diff) m Stanford Biochemistry/Suggestions for Department Website‎ (Suggestions for Department Website moved to /Stanford Biochemistry/Suggestions for Department Website: reorganizing)
• 00:46, 26 February 2010 (hist) (diff) Nm IGEM:Stanford/2010/Protocols‎ (New page: {{Template:Stanford_Main_Menu_0910}} <div style="width:720px;text-align:justify"> </div>)
• 00:46, 26 February 2010 (hist) (diff) m Template:Stanford Main Menu 0910‎ (top)
• 19:43, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list‎
• 19:08, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list/Superspeed centrifuge‎ (top)
• 19:07, 22 February 2010 (hist) (diff) N Image:Superspeed instructions.doc‎ (top)
• 19:06, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list/Superspeed centrifuge‎
• 19:05, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list‎
• 19:04, 22 February 2010 (hist) (diff) N Stanford Biochemistry/equipment list/ultracentrifuge‎ (Stanford Biochemistry/equipment list/ultracentrifuge moved to Stanford Biochemistry/equipment list/Superspeed centrifuge) (top)
• 19:04, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list/Superspeed centrifuge‎ (Stanford Biochemistry/equipment list/ultracentrifuge moved to Stanford Biochemistry/equipment list/Superspeed centrifuge)
• 19:04, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list/Superspeed centrifuge‎
• 19:02, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list/Superspeed centrifuge‎
• 19:02, 22 February 2010 (hist) (diff) N Image:Ultracentrifuge instructions.doc‎ (top)
• 18:59, 22 February 2010 (hist) (diff) m Stanford Biochemistry/equipment list/Superspeed centrifuge‎
• 18:58, 22 February 2010 (hist) (diff) Nm Stanford Biochemistry/equipment list/Superspeed centrifuge‎ (New page: We have 4 ultracentrifuges in room B430)
• 18:58, 22 February 2010 (hist) (diff) Nm Stanford Biochemistry/equipment list‎ (New page: ultracentrifuge)
• 18:57, 22 February 2010 (hist) (diff) m Stanford Biochemistry‎
• 18:57, 22 February 2010 (hist) (diff) m Stanford Biochemistry‎
• 18:55, 22 February 2010 (hist) (diff) m Stanford Biochemistry‎
• 18:54, 22 February 2010 (hist) (diff) Nm Stanford Biochemistry‎ (New page: Welcome to the Stanford Department of Biochemistry facilities and equipment information page [http://biochemistry.stanford.edu/ Our homepage])
• 15:17, 19 February 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Graduates‎
• 15:16, 19 February 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Graduates‎
• 15:16, 19 February 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Graduates‎
• 03:21, 18 February 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→Meeting Notes)
• 21:29, 27 January 2010 (hist) (diff) m IGEM‎ (→2010)
• 15:18, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010/Team‎ (top)
• 15:16, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010/Team‎
• 15:15, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010/Team‎
• 15:14, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010/Team/Undergraduates‎
• 15:12, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010/Team‎
• 15:09, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010‎ (→Welcome to the Stanford team Wiki for iGEM 2010)
• 02:36, 26 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 January 2010‎ (top)
• 19:49, 24 January 2010 (hist) (diff) m IGEM:Stanford/2010‎ (→Welcome to the Stanford team Wiki for iGEM 2010)
• 17:25, 23 January 2010 (hist) (diff) m IGEM:Stanford/2010‎ (→Welcome to the Stanford team Wiki for iGEM 2010)
• 17:24, 23 January 2010 (hist) (diff) m IGEM:Stanford/2010‎ (→Calendar)
• 23:21, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 January 2010‎ (→Meeting Notes)
• 23:20, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 January 2010‎ (→Meeting Notes)
• 23:19, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 23:19, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→20_January_2010)
• 23:19, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 23:18, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook/20 January 2010‎
• 23:17, 22 January 2010 (hist) (diff) Nm IGEM:Stanford/2010/Notebook/20 January 2010‎ (New page: *Interviews **Open ***Would help form a club ***Difficult dynamic with club and team, too divisive **Closed ***Recommendations from Faculty, Grad/peer ***Due Mid february ***Rubric should ...)
• 23:17, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→/20_January_2010)
• 23:16, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 23:11, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎ (→1/20/10)
• 23:05, 22 January 2010 (hist) (diff) m IGEM:Stanford/2010/Notebook‎
• 21:50, 16 January 2010 (hist) (diff) m IGEM:Stanford/2010‎
• 20:16, 16 January 2010 (hist) (diff) m Template:Stanford Main Menu 0910‎
• 20:15, 16 January 2010 (hist) (diff) m IGEM:Stanford/2010‎
• 20:15, 16 January 2010 (hist) (diff) m IGEM:Stanford/2010‎
• 19:43, 16 January 2010 (hist) (diff) m Template:Stanford Main Menu 0809‎ (top)

(Latest | Earliest) View (newer 500) (older 500) (20 | 50 | 100 | 250 | 500)