Ssbb14-Christopher J. Coates: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(14 intermediate revisions by the same user not shown)
Line 6: Line 6:


http://openwetware.org/wiki/SBB10_protocols
http://openwetware.org/wiki/SBB10_protocols
<b> NEB 2-log ladder (10-0.1kb): </b>
[http://66.155.211.155/nebecomm/products_intl/productN3200.asp used for all prepatory and analytic gels]


<b> Preparation and Theory: </b>
<b> Preparation and Theory: </b>
Line 32: Line 36:
  PCR arginyl-F/arginyl-R on Thermotoga Maritima (full)  (1674bp, pcrpdt)
  PCR arginyl-F/arginyl-R on Thermotoga Maritima (full)  (1674bp, pcrpdt)
  Digest pcrpdt                        (Bsa1, 5+1658+11, L, pcrdig)
  Digest pcrpdt                        (Bsa1, 5+1658+11, L, pcrdig)
  Digest pBAD-myc-his-A                (Nco1/EcoR1, 4053+1252, L, vectdig)
  Digest pNE200_OleD              (Nco1/EcoR1, 4053+1252, L, vectdig)
  Ligate pcrdig and vectdig            (pBAD-arginylRS)
  Ligate pcrdig and vectdig            (pBAD-arginylRS)
  --
  --
Line 52: Line 56:
  PCR seryl-F/seryl-R on Thermotoga Maritima (full)      (1311bp, pcrpdt)
  PCR seryl-F/seryl-R on Thermotoga Maritima (full)      (1311bp, pcrpdt)
  Digest pcrpdt                        (Bsa1, 5+1295+11, L, pcrdig)
  Digest pcrpdt                        (Bsa1, 5+1295+11, L, pcrdig)
  Digest pBAD-myc-his-A                (Nco1/EcoR1, 4053+1252, L, vectdig)
  Digest pNE200_OleD              (Nco1/EcoR1, 4053+1252, L, vectdig)
  Ligate pcrdig and vectdig            (pBAD-serylRS)
  Ligate pcrdig and vectdig            (pBAD-serylRS)
  -----------------------------------------
  -----------------------------------------
Line 116: Line 120:


Good definition of bands matching roughly the proper size of previous bands. With Ser more advanced than Arg due to its smaller size. pBad1 had ghost banding from monocut (overloaded reaction?) and therefore only pBad2 digest was used for ligation. Note that the vector breaks into ~4kb and ~1.3kb, therefore ArgRS of ~1.7kb and SerRS of ~1.3kb line up perfectly.
Good definition of bands matching roughly the proper size of previous bands. With Ser more advanced than Arg due to its smaller size. pBad1 had ghost banding from monocut (overloaded reaction?) and therefore only pBad2 digest was used for ligation. Note that the vector breaks into ~4kb and ~1.3kb, therefore ArgRS of ~1.7kb and SerRS of ~1.3kb line up perfectly.


<b> Apr 3. 2014.</b>
<b> Apr 3. 2014.</b>
Line 132: Line 137:
<b> Apr 5. 2014.</b>
<b> Apr 5. 2014.</b>


Zymo clean digested ArgRS and SerRS (according to protocol).
Zymo clean digested pBad2, ArgRS, and SerRS (according to protocol).


Ligate previous Vect digest with ArgRS and SerRS according to construction file (according to protocol).
Ligate previous Vect digest with ArgRS and SerRS according to construction file (according to protocol).
Line 138: Line 143:
Transform ligation products into E.coli (according to heat shock protocol w/ recovery step)
Transform ligation products into E.coli (according to heat shock protocol w/ recovery step)


Plate (according to protocol)
Plate Arg, Ser, and Untransformed E. coli (according to protocol)




Line 150: Line 155:
<b> Apr 10. 2014.</b>
<b> Apr 10. 2014.</b>


Miniprep cultured media according to protocol.
Miniprep cultured media (Arg1, Arg2, Ser1, Ser2 inclusive pBad plasmids) according to protocol.
 
Determine which internal restrictions sites to use to restriction map. Settle on BamH1 for Arg and EcoR1 for Ser.
Determine which internal restrictions sites to use to restriction map. Settle on BamH1 for Arg and EcoR1 for Ser.


Line 162: Line 168:


Digest Arg products with BamH1 using listed protocol.
Digest Arg products with BamH1 using listed protocol.
Digest Ser products with EcoR1 using listed protocol.
Digest Ser products with EcoR1 using listed protocol.
Run Gel: [ladder vectdig arg1dig arg2dig vectdig ser1dig ser2dig]
Run Gel: [ladder vectdig arg1dig arg2dig vectdig ser1dig ser2dig]
[[Image:Chris final pcr 4-17-14.jpg]]
[[Image:Chris final pcr 4-17-14.jpg]]




BamH1 breaks the vector into a single ~5kb fragment, Arg into a ~200bp, ~1.4kb, and ~4kb fragment, and Ser into a ~5kb and a ~200bp fragment.
BamH1 breaks the Vect into a single ~5.3kb fragment, Arg into a ~200bp, ~1.4kb, and ~4kb fragment, and EcoR1 breaks Vect into 1 ~5.3kb fragment and Ser into a ~4.5kb and a ~800bp fragment.
Gel shows good banding for Ser, can send for sequencing.
Gel shows good banding for Ser, can send for sequencing.


Line 178: Line 187:


Digest Arg and Vect with alternative restriction enzyme BglII
Digest Arg and Vect with alternative restriction enzyme BglII
Run analytical gel: [ladder [] [] [] vectdig arg1dig arg2dig [...]]
Run analytical gel: [ladder [] [] [] vectdig arg1dig arg2dig [...]]
[[Image:Chris Tae Kelvin 2014-04-22.jpg]]
[[Image:Chris Tae Kelvin 2014-04-22.jpg]]


Line 189: Line 200:
Digest Vect, Arg1, and Arg2 with BamH1 again, compare to controls of undigested Vect, Arg1, Arg2.
Digest Vect, Arg1, and Arg2 with BamH1 again, compare to controls of undigested Vect, Arg1, Arg2.


Run final gel to determine sequencing. Accidentally loaded lanes 2,3,4 with ladder instead of loading dye. Someone altered voltage to 180V and melted my gel mid run. No useful results:
Run final gel to prove (instead of speculate about ghost banding) for sequencing. Accidentally loaded lanes 2,3,4 with ladder instead of loading dye. Someone altered voltage to 180V and melted my gel mid run. No useful results:
 
[[Image:Chris 2014 5 1.jpg]]
[[Image:Chris 2014 5 1.jpg]]


Line 196: Line 208:


Submit samples based on previous evidence.
Submit samples based on previous evidence.
Sequencing too late, never sent. However it seems clear from good colonies and clear early analytical gels that the part was transformed. And digestions partially confirm incorporation for Arg1 and definitely confirm for Ser1. Therefore the experiment has been reasonably carried.  
Sequencing too late, never sent. However it seems clear from good colonies and clear early analytical gels that the parts were transformed. Digestions partially confirm incorporation for Arg1 and definitely confirm for Ser1. Therefore the experiment has been reasonably carried to success.  


There are a number of easy luciferase assays for ATP consumption available. It would have taken minimal resources to confirm activity of the t-RNA synthetases post boiling and this seems a logical next step. If these assays demonstrate little to no activity then a western blot may be performed to ensure expression of the fragment and stability after boiling. If expressing and non-functional then a different target should probably be chosen. Although ideally there would be enough final part targets to analyze multiple parts before abandoning the protein.
There are a number of easy luciferase assays for ATP consumption available. It would have taken minimal resources to confirm activity of the t-RNA synthetases post boiling and this seems a logical next step. If these assays demonstrate little to no activity then a western blot may be performed to ensure expression of the fragment and stability after boiling. If expressing and non-functional then a different target should probably be chosen. Although ideally there would be enough final part targets to analyze multiple parts before abandoning the protein.

Latest revision as of 02:10, 16 May 2014

~~!~~

Chris Coates: Preparation of pBad promoted Arginyl-tRNA synthetase and Seryl-tRNA synthetase from Thermatoga maldima in E. coli

List of all protocol used:

http://openwetware.org/wiki/SBB10_protocols

NEB 2-log ladder (10-0.1kb):

used for all prepatory and analytic gels

Preparation and Theory:

We have set out to express hyperthermophillic tRNA-synthetases in E. coli so that we may easily express and purify them by boiling to denature other host proteins. This will allow for rapid purification of tRNA-synthtases for use in in vitro applications.

We had a class conversation to establish good candidate gene sources and settled on Thermus thermophilus and Thermatoga maldima. Aquivex aeolicus was considered until logistics prevented acquisition of genomic DNA. There is some question as to the degree of relatedness between hyperthermophiles and E. coli because a large number of genes, even house keeping genes, have been collected from lateral gene transfer. This makes evolutionary relatedness difficult to discern, and therefore candidate organism tRNA synthetases may not interact with E. coli sourced tRNAs (as we desire).

Gene Sequences:

plasmid pNE200_OleD (pBad) source

Thermatoga maldima complete sequence source

arginyl-tRNA synthetase source

seryl-tRNA synthetase source

Construction files:

Arginyl-tRNA synthetase expected final part and construction file


Construction file for ArgRS

PCR arginyl-F/arginyl-R on Thermotoga Maritima (full)   (1674bp, pcrpdt)
Digest pcrpdt                         			(Bsa1, 5+1658+11, L, pcrdig)
Digest pNE200_OleD              			(Nco1/EcoR1, 4053+1252, L, vectdig)
Ligate pcrdig and vectdig             			(pBAD-arginylRS)
--
>arginyl-F   Cloning of arginylRS + Nco1 stickyend
ccagtGGTCTCCCATGGcaCTGGTGAACGCGATCAGGC
>arginyl-R   Cloning of arginylRS + EcoR1 stickyend
ccagtGGTCTCGAATTCTCACATCCTCTCTGGTGCGG
>Thermotoga Maritima arginylRS region of Thermotoga Maritima (full)
gtgctggtgaacgcgatcaggcaaaaggtgtccgaagtcatctctaaagcgtacggttcagaaatcgaattcgaggtcgaaattccacccagaaaggaattcggagatctgtccaccaacgttgccatgaagctcgcaaaaactttgaagaaaaacccgcgggagatagctcaggagatcgtaaaaagtctcgatgaagatccctcgtttgacaggatagaaatcatgggacccggtttcataaatttcttcctgtcgaacgaactgctccgtggagtggttaaaaccgtgctggagaaaaaagacgagtacgggagagagaacgttggaaatggaatgaaggtgcagttcgaatacggaagtgcaaacccaacgggaccattcaccgttgggcacggtagacagatcatcataggtgacgtgctttccgaggtttacaaagagctcggttacgatgtgacgagggaaatgtatataaacgacgccggaaagcagataaggcttctcgctcagtcgctttgggcaaggtacaatcagcttctcggagttgaaaaagaaattcccgaagggggctatcgcggggaatacctcgtggacatcgcgagggatctggtgaacgaaatcggagatagatacaaagatctgtggaacgaagaagtggaggagtttttcaaacagacagcgctgaacagaattctctcctccatgaaagatacccttgaaaagattggttcttcgttcgatgtgtacttctcagaaaagagtttgatagaggatgggactgtcgaagaggtgctgaaactcctcaagaacaaggacgttgtttacgaaaaagacggtgctgtgtggttgaaagtctctgccttcatagatgaggaagacaaggttcttgtgagaagcgacggtacatacacgtacttcatgacggatatcgcgtatcactacaagaaatataagagaggcttcaggaaggtttacgacatctggggtagtgaccatcacggtcacataccaagaatgaaggcagcgatgaaagccctcgacattcccgacgatttcttcaacgttatactgcatcagttcgttactctgaaacgtggtggggaaatcgttcgcatgtccacgcgagcgggagaattcgtcactctggacgaacttctcgacgaagtgggaagagacgccacccgatatttctttgcgatggtggaccccaatacccacatggtgttcgatatcgatctggcgaaggccaaatccatggacaacccagtttactacgttcagtacgcacatgccaggatccacaatctcttctccaacgcggaaaagaaaggtgtgaagtttgaagagggaaaacaccttgaactgcttggaaacgaagaagaaagggttctgatgagaaacctcggtatgttcaacaccgctttgaaagaggtcgcgcagatgttcgcaccaaacaggctcacgaactatctccagtcgcttgctgagtccttccacgcattctacaccaaacacgtgatagtggatcctgaaaatcccgaactttcgaacgcgcgactcaaccttgccctcgcaacgggtatcgttttaagaaagggtctgaaactcataggagtttccgcaccagagaggatgtga
>pBAD pNE2001 OleD
CATGGCTACCACCCAGACCACTCCCGCCCACATCGCCATGTTCTCCATCGCCGCCCACGGCCATGTGAACCCCAGCCTGGAGGTGATCCGTGAACTCGTCGCCCGCGGCCACCGGGTCACGTACGCCATTCCGCCCGTCTTCGCCGACAAGGTGGCCGCCACCGGCGCCCGGCCCGTCCTCTACCACTCCACCCTGCCCGGCCCCGACGCCGACCCGGAGGCATGGGGAAGCACCCTGCTGGACAACGTCGAACCGTTCCTGAACGACGCGATCCAGGCGCTCCCGCAGCTCGCCGATGCCTACGCCGACGACATCCCCGATCTCGTCCTGCACGACATCACCTCCTACCCGGCCCGCGTCCTGGCCCGCCGCTGGGGCGTCCCGGCGGTCTCCCTCTCCCCGAACCTCGTCGCCTGGAAGGGTTACGAGGAGGAGGTCGCCGAGCCGATGTGGCGCGAACCCCGGCAGACCGAGCGCGGACGGGCCTACTACGCCCGGTTCGAGGCATGGCTGAAGGAGAACGGGATCACCGAGCACCCGGACACGTTCGCCAGTCATCCGCCGCGCTCCCTGGTGCTCATCCCGAAGGCGCTCCAGCCGCACGCCGACCGGGTGGACGAAGACGTGTACACCTTCGTCGGCGCCTGCCAGGGAGACCGCGCCGAGGAAGGCGGCTGGCAGCGGCCCGCCGGCGCGGAGAAGGTCGTCCTGGTGTCGCTCGGCTCGGCGTTCACCAAGCAGCCCGCCTTCTACCGGGAGTGCGTGCGCGCCTTCGGGAACCTGCCCGGCTGGCACCTCGTCCTCCAGATCGGCCGGAAGGTGACCCCCGCCGAACTGGGGGAGCTGCCGGACAACGTGGAGGTGCACGACTGGGTGCCGCAGCTCGCGATCCTGCGCCAGGCCGATCTGTTCGTCACCCACGCGGGCGCCGGCGGCAGCCAGGAGGGGCTGGCCACCGCGACGCCCATGATCGCCGTACCGCAGGCCGTCGACCAGTTCGGCAACGCCGACATGCTCCAAGGGCTCGGCGTCGCCCGGAAGCTGGCGACCGAGGAGGCCACCGCCGACCTGCTCCGCGAGACCGCCCTCGCTCTGGTGGACGACCCGGAGGTCGCGCGCCGGCTCCGGCGAATCCAGGCGGAGATGGCCCAGGAGGGCGGCACCCGGCGGGCGGCCGACCTCATCGAGGCCGAACTGCCCGCGCGCCACGAGCGGCAGGAGCCGGTGGGCGACCGACCCAACGGTGGGGGGAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAACAGGAGGAATTAAC


Seryl-tRNA synthetase expected final part and construction file


Construction file for SerRS

PCR seryl-F/seryl-R on Thermotoga Maritima (full)       (1311bp, pcrpdt)
Digest pcrpdt                         			(Bsa1, 5+1295+11, L, pcrdig)
Digest pNE200_OleD               			(Nco1/EcoR1, 4053+1252, L, vectdig)
Ligate pcrdig and vectdig             			(pBAD-serylRS)
-----------------------------------------
>seryl-F   Cloning of serylRS + Nco1 stickyend
ccagtGGTCTCCCATGGcaATAGATATAAAGCTCATCAG
>seryl-R   Cloning of serylRS + EcoR1 stickyend
ccagtGGTCTCGAATTCCTACGGTATCACCTCGAACC
>Thermotoga Maritima serylRS region of Thermotoga Maritima (full)
atgatagatataaagctcatcagacaaaatcccgatttcgtgaaggaagccctcagaaagcgaggagaggatcccgctataatcgatgagattttgaagatcgacgccgactggcgcgctaccatcacgaaaaccaacgagctgagatccagaagaaacgaaatttccaaaaatgtggcaaggttgaaaaaagaagggaaaaacgcagaggcagaggcactcatcgaggaagggaaaagattaggagaagagataaaagcgttagaagaaaaagaaaaagaacttcagaagaagttaaacgatcttcttttgatgattccgaacatcccgcatgagagtgtccccgttggagaagacgaatctcagaacgttgaagtgagaaggtggggagagccgagagaattcgacttcaccccgctcgctcactgggacctcggacctgcgtgggggctcatggatttcagcagggcgtccaagctcagcggttccagattcaccgttatgtatggaaaactcgcaagactcgagagggctctgataaacttcatgcttgacgttcatacaaaggaacacggttacacggaagtgtgggttccacacctggtgaaaagagaaaccatcaccataaccggacagctccccaaattcgaagaagagctttatcttgctgagagggatgacctgttcctcattccgacggctgaggttcccctcgcagcgcttcacagtggagagatcctcgaagagaaagaactaccaaagaaatacgtctcttacactccctgttaccgcagagaagcgggaagttacgggaaagacgtgagggggatgatcaggcagcatcaattcgacaaggtcgagctcgtctgggtgaccacaccggaaagatccttcgaagatcttgaagagcttgtgaaagacgccgaaaccattcttagaaaattggagctcccttacagagtcgtttcgctctgtacgggagatctcggattcacctccgcgaaaacctacgatatagaagtgtggcttccttcctacaacgcatacaaagagatatcttcctgcagtaacgtgacggactttcaggcgagaagaggaaacatgagatacagaaggagatcggatggaaagctcgaatacgttcacacgttgaacggatcgggtatcgccgttggaagggcactcgttgcgatactggaaaactaccagcaaccagacggcagtgtgagagtgccggaggtgctcgttccctacacagggttcgaggtgataccgtag
>pBAD pNE2001 OleD
CATGGCTACCACCCAGACCACTCCCGCCCACATCGCCATGTTCTCCATCGCCGCCCACGGCCATGTGAACCCCAGCCTGGAGGTGATCCGTGAACTCGTCGCCCGCGGCCACCGGGTCACGTACGCCATTCCGCCCGTCTTCGCCGACAAGGTGGCCGCCACCGGCGCCCGGCCCGTCCTCTACCACTCCACCCTGCCCGGCCCCGACGCCGACCCGGAGGCATGGGGAAGCACCCTGCTGGACAACGTCGAACCGTTCCTGAACGACGCGATCCAGGCGCTCCCGCAGCTCGCCGATGCCTACGCCGACGACATCCCCGATCTCGTCCTGCACGACATCACCTCCTACCCGGCCCGCGTCCTGGCCCGCCGCTGGGGCGTCCCGGCGGTCTCCCTCTCCCCGAACCTCGTCGCCTGGAAGGGTTACGAGGAGGAGGTCGCCGAGCCGATGTGGCGCGAACCCCGGCAGACCGAGCGCGGACGGGCCTACTACGCCCGGTTCGAGGCATGGCTGAAGGAGAACGGGATCACCGAGCACCCGGACACGTTCGCCAGTCATCCGCCGCGCTCCCTGGTGCTCATCCCGAAGGCGCTCCAGCCGCACGCCGACCGGGTGGACGAAGACGTGTACACCTTCGTCGGCGCCTGCCAGGGAGACCGCGCCGAGGAAGGCGGCTGGCAGCGGCCCGCCGGCGCGGAGAAGGTCGTCCTGGTGTCGCTCGGCTCGGCGTTCACCAAGCAGCCCGCCTTCTACCGGGAGTGCGTGCGCGCCTTCGGGAACCTGCCCGGCTGGCACCTCGTCCTCCAGATCGGCCGGAAGGTGACCCCCGCCGAACTGGGGGAGCTGCCGGACAACGTGGAGGTGCACGACTGGGTGCCGCAGCTCGCGATCCTGCGCCAGGCCGATCTGTTCGTCACCCACGCGGGCGCCGGCGGCAGCCAGGAGGGGCTGGCCACCGCGACGCCCATGATCGCCGTACCGCAGGCCGTCGACCAGTTCGGCAACGCCGACATGCTCCAAGGGCTCGGCGTCGCCCGGAAGCTGGCGACCGAGGAGGCCACCGCCGACCTGCTCCGCGAGACCGCCCTCGCTCTGGTGGACGACCCGGAGGTCGCGCGCCGGCTCCGGCGAATCCAGGCGGAGATGGCCCAGGAGGGCGGCACCCGGCGGGCGGCCGACCTCATCGAGGCCGAACTGCCCGCGCGCCACGAGCGGCAGGAGCCGGTGGGCGACCGACCCAACGGTGGGGGGAATTCGAAGCTTGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAACAGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAGATCAATTCGCGCGCGAAGGCGAAGCGGCATGCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAACAGGAGGAATTAAC


Notebook:

Feb 13. 2014.

Assigned Arginine-aaRS and Serine-aaRS from Thermatoga maritima.

Designed primers and construction files for incorporation into pBad plasmid. Notably both the gene source for arginyl-tRNA synthetase and seryl-tRNA synthetase included a number of internal restrictions which limited the ability to biobrick the part. Instead they were designed with Bsa1 sticky ends, which could be used to mimic cutting with EcoR1 and Nco1 (the pBad plasmid sticky ends) without actually requiring those digests. These internal restriction sites will be useful for mapping the product, but will destroy the part in any attempt at excision from the host plasmid. Because the pBad promoter is very highly conserved, Bsa1 needed to be excluded from the part sequence and thus was placed external to the EcoR1 and Nco1 sites. This means that the part may not be excised by Bsa1 either.


Feb 27. 2014.

DNA miniprep from cells to isolate pNE200_OleD (pBad) according to listed protocol. Performed once, and resultant was sufficient to characterize all other experiments.


Mar 4. 2014.

PCR according to construction files and listed protocol for ArgRS and SerRS synthesis. Resulting PCR was stopped and frozen by Danny when finished.


Mar 6. 2014.

Ran analytical gel on PCR products using listed protocol. Loaded 3ul of ladder for better band definition. Ladder is in first lane, ArgRS in third, SerRS in fourth

[ladder, [], [], ArgRS, SerRS, [...]]

Note ArgRS is ~1700bp and SerRS is ~1300bp

Zymo clean up of ArgRS and SerRS bands. Everything looked good and clean.


Mar 18. 2014.

Digested pcrpdts and vector 2x according to construction files using listed protocol. Quenched with 3x ADB buffer.


Mar 20. 2014.

Ran prepatory gel [ladder [] [] [] [] ArgRS SerRS]. Everything looked clean but SerRS band very, very faint. Will re-perform digestion after break.


Apr 1. 2014.

Digest Vector, ArgRS, and SerRS according to construction file and Re-ran prepatory gel, Banding came out clean, excised and stored.

[ladder pBad pBad ArgRS SerRS [...]]

Good definition of bands matching roughly the proper size of previous bands. With Ser more advanced than Arg due to its smaller size. pBad1 had ghost banding from monocut (overloaded reaction?) and therefore only pBad2 digest was used for ligation. Note that the vector breaks into ~4kb and ~1.3kb, therefore ArgRS of ~1.7kb and SerRS of ~1.3kb line up perfectly.


Apr 3. 2014.

Zymo clean

Ligate

Transform

Plate

Was uncomfortable enough with procedure to perform sensitive/critical methods in one lab period (necessary) so waited until next lab. Others in lab group frequently failed to transform and ate up limited pcr product, having to re-perform the above in order to return to this step.


Apr 5. 2014.

Zymo clean digested pBad2, ArgRS, and SerRS (according to protocol).

Ligate previous Vect digest with ArgRS and SerRS according to construction file (according to protocol).

Transform ligation products into E.coli (according to heat shock protocol w/ recovery step)

Plate Arg, Ser, and Untransformed E. coli (according to protocol)


Apr 8. 2014.

Checked colonies, everything looked great (many well spaced colonies, no growth on negative control plate). Picked 2 Arg and 2 Ser now labelled Arg1, Arg2, Ser1, Ser2.

Inoculated picks into incubation growth media and informed Danny


Apr 10. 2014.

Miniprep cultured media (Arg1, Arg2, Ser1, Ser2 inclusive pBad plasmids) according to protocol.

Determine which internal restrictions sites to use to restriction map. Settle on BamH1 for Arg and EcoR1 for Ser.


Apr 15. 2014.

Attempted to pour gel and digest, but was unable to get dams to make the gel. Had to remake gel after previous solidified. Will now always remember to find dams before microwaving gel. Not enough time to digest, run, and zymo clean samples so will leave new gel with 1x TAE in a pipette box for future use.


Apr 17. 2014.

Digest Arg products with BamH1 using listed protocol.

Digest Ser products with EcoR1 using listed protocol.

Run Gel: [ladder vectdig arg1dig arg2dig vectdig ser1dig ser2dig]


BamH1 breaks the Vect into a single ~5.3kb fragment, Arg into a ~200bp, ~1.4kb, and ~4kb fragment, and EcoR1 breaks Vect into 1 ~5.3kb fragment and Ser into a ~4.5kb and a ~800bp fragment. Gel shows good banding for Ser, can send for sequencing.

Ambiguous ghost banding for Arg, although it demonstrates the two expected digest bands on top of what was suggested to me to be uncut and monocut vector. Alternative mapping required. The important difference here is that there are clearly internal restriction sites within Arg1 and Ser1 that don't exist within the parent vector or Arg2 or Ser2 (which are likely parent vector as well). This difference suggests some incorporation of part, and due to previous gels which confirm the size of the part fragments, those parts are likely correct.

Miniprepped pBad from cells for others in group according to listed protocol.


Apr 22. 2014.

Digest Arg and Vect with alternative restriction enzyme BglII

Run analytical gel: [ladder [] [] [] vectdig arg1dig arg2dig [...]]

Ghost banding makes analysis difficult. Previous analysis suggests that Ser1 is correct and Arg1 is probably correct. The Vect is meant to be uncut, and the Arg vector is meant to have a roughly ~5kb and ~500bp fragment. Under UV there appears to be a very feint 500bp band within the streak, it's visible in the image but only slightly. The part is present in Arg1, but importantly there is definitely something wrong with the digestions for pure vector (that notably weren't present when Ser was prepared or compared to) and this has remained unresolved.


May 1. 2014.

Digest Vect, Arg1, and Arg2 with BamH1 again, compare to controls of undigested Vect, Arg1, Arg2.

Run final gel to prove (instead of speculate about ghost banding) for sequencing. Accidentally loaded lanes 2,3,4 with ladder instead of loading dye. Someone altered voltage to 180V and melted my gel mid run. No useful results:

[ladder vect arg1 arg2 vectdig arg1dig arg2dig arg1 arg2]


Submit samples based on previous evidence. Sequencing too late, never sent. However it seems clear from good colonies and clear early analytical gels that the parts were transformed. Digestions partially confirm incorporation for Arg1 and definitely confirm for Ser1. Therefore the experiment has been reasonably carried to success.

There are a number of easy luciferase assays for ATP consumption available. It would have taken minimal resources to confirm activity of the t-RNA synthetases post boiling and this seems a logical next step. If these assays demonstrate little to no activity then a western blot may be performed to ensure expression of the fragment and stability after boiling. If expressing and non-functional then a different target should probably be chosen. Although ideally there would be enough final part targets to analyze multiple parts before abandoning the protein.