Stanford/BIOE44:Module3:Day2:atrazine: Difference between revisions
No edit summary |
No edit summary |
||
Line 27: | Line 27: | ||
gaattcgcggccgcttctagagcatgcgagtcaaagcaagatcggtgccggatcggcaccagttaggtcggaaaaaggcggcagtcaagtgcgcagggcggcgttaagcttgaacgaatactagta | gaattcgcggccgcttctagagcatgcgagtcaaagcaagatcggtgccggatcggcaccagttaggtcggaaaaaggcggcagtcaagtgcgcagggcggcgttaagcttgaacgaatactagta | ||
gcggccgctgcag | gcggccgctgcag | ||
'''Long Description:''' The atzR, atzDEF operon region is the regulatory region for the atzR gene and the atzDEF genes. This operon is regulated by AtzR, which binds to the atzR promoter and atzDEF promoter, blocking/repressing it. The presence of cyanuric acid “frees” AtzR from being bound to the atzDEF promoter so RNA polymerase can now bind and transcribe following gene. AtzR remains bound to the atzR promoter region even in the presence of cyanuric acid. No enzyme sites were altered in making the standardized BioBrick part. | '''Long Description:''' The atzR, atzDEF operon region is the regulatory region for the atzR gene and the atzDEF genes. This operon is regulated by AtzR, which binds to the atzR promoter and atzDEF promoter, blocking/repressing it. The presence of cyanuric acid “frees” AtzR from being bound to the atzDEF promoter so RNA polymerase can now bind and transcribe following gene. AtzR remains bound to the atzR promoter region even in the presence of cyanuric acid. No enzyme sites were altered in making the standardized BioBrick part. | ||
Line 32: | Line 33: | ||
'''Short Description:''' Coding sequence for the atzR, atzDEF operon region. Regulated by the binding of AtzR protein. | '''Short Description:''' Coding sequence for the atzR, atzDEF operon region. Regulated by the binding of AtzR protein. | ||
'''Sequence Information''' | '''Sequence Information''' | ||
Link to [http://www.ncbi.nlm.nih.gov/nuccore/13937422] | Link to [http://www.ncbi.nlm.nih.gov/nuccore/13937422] | ||
Revision as of 15:25, 4 May 2010
1. reverse complement of atzR (969 bp) (bp #99885..100853 on Psuedomonas sp. ADP http://www.ncbi.nlm.nih.gov/nuccore/13937422)
gaattcgcggccgcttctagagtcacgttgcattgtgggtcgtatcagcgagcttgccggcgacgaactccgcaaatgccgccgatgccacaggcagcaccctctcacgcaatgcgaccagtacga cgcgtccggaagccaggctgcgctcgtcgattggaattgcaacctcaccctccgtggaaccagcaccgatctcgatctgaaagctcaccccaccggtttcgcgggcaaaaccgcgcatcatttcgt aggaattactgaccagttgaggccgcggtcgagctgatgatttgtcgaataactcgtccaacacgttgcgcccggagagactgctgtccggtagcgcaagggggtagtccaggcaatctttcagac gcagactcgtacgcttcgcgagcggatggtcggaagcaacgacggcacagatgcgttgccgcgcttgtgcaatgacagtcaaaccgcgcaggtccgggggattgaagaccagcgccaggtcggccg cgaaatccgtcacggcgagaacagcacgctcgcggtccagcacctttacgtcgaaggcaatacctggacgttgggcctggaacgcgtgtattacgcggggcaggaactccggagccagcgcctggc tggctgccaatgtcacacggccgcgtttcatgccgctgagatcctggatctgtgactggacttgttccagatcggcattgcggcgacgagcgtaggcaacgaacagttcgcctgccgcagtcaggc gtacaccacgcggcagacgctcgaaaatcggcgtacctaactcgtattccagatcctggacgcggcgatttaccgctgatgcggcgacgtgcagctgttctgcggcggcccgaatggagccgcagc gagccacggcatcgatgtaatgaagaaagcgtaaatgttgcataggtggtcgaagtaaaaaggatggaatagagatggcctgtatcgctgacggccgctgtgcccgcattactagtagcggccgct gcag
EcoRI (3), NotI (1) removed
2. reverse complement of constitutive promoter J23101 (35bp) (from http://partsregistry.org/Part:BBa_J23101:Design)
gaattcgcggccgcttctagaggctagcataatacctaggactgagctagctgtaaatactagtagcggccgctgcag
-no enzyme sites
3. atzDEF operator region (96 bp) (bp #100851..100946 on Psuedomonas sp. ADP http://www.ncbi.nlm.nih.gov/nuccore/13937422)
Sequence
gaattcgcggccgcttctagagcatgcgagtcaaagcaagatcggtgccggatcggcaccagttaggtcggaaaaaggcggcagtcaagtgcgcagggcggcgttaagcttgaacgaatactagta gcggccgctgcag
Long Description: The atzR, atzDEF operon region is the regulatory region for the atzR gene and the atzDEF genes. This operon is regulated by AtzR, which binds to the atzR promoter and atzDEF promoter, blocking/repressing it. The presence of cyanuric acid “frees” AtzR from being bound to the atzDEF promoter so RNA polymerase can now bind and transcribe following gene. AtzR remains bound to the atzR promoter region even in the presence of cyanuric acid. No enzyme sites were altered in making the standardized BioBrick part.
Short Description: Coding sequence for the atzR, atzDEF operon region. Regulated by the binding of AtzR protein.
Sequence Information
Link to [1]
4. glnK from Psuedomonas putida KT2440 (339 bp) (bp #5967730..5968070 on Psuedomonas putida KT2440 http://www.ncbi.nlm.nih.gov/nuccore/NC_009512)
gaattcgcggccgcttctagatgaagctagtcacagccatcatcaagccgttcaagctggacgacgtgcgcgagtcgctgtcggaaatcggcgtgcagggcatcaccgtcaccgaagtcaaaggttt cggtcggcagaagggccacaccgagctgtatcgcggtgctgaatatgtggtcgatttcctgcccaaggtgaagatcgatgtcgccatcgatgacaaagaccttgatcgggtaatcgaagccatcacc aaggcagccaacaccggcaagatcggtgacggcaagattttcgtggtgaatctggagcaggcgatccgcatccgtaccggcgaaaccgataccgacgcgatctaatactagtagcggccgctgcag
-no enzyme sites