Stanford/BIOE44:Module3:Day2:nitrate: Difference between revisions
No edit summary |
No edit summary |
||
Line 1: | Line 1: | ||
{{Template:Stanford/BioE44}} | {{Template:Stanford/BioE44}} | ||
==STATUS== | |||
Loaded up at DNA2.0 and authors have confirmed sequence is correct. Good to order! | |||
'''Nitrate Sensor Project''' | '''Nitrate Sensor Project''' |
Revision as of 15:07, 4 May 2010
STATUS
Loaded up at DNA2.0 and authors have confirmed sequence is correct. Good to order!
Nitrate Sensor Project
Authors: Scott Runyon and Travis Urban
Novel Bio Bricks Part: Bba_NRL001
Long Description: To develop a functional nitrate sensor, our group is attempting to couple the two-component Nar pathway to an RFP reporter to observe RFP expression in response to different concentrations of nitrate. Because our sensor needs to be able to detect nitrate levels of 10 ppm (the MCL designated by the EPA), our group decided to create a part containing the NarL coding sequence. We plan on inserting the NarL cds downstream of a RBS and constitutive promoter in order to potentially enhance the signal of RFP expression in response to nitrate activation of the two-component pathway. Nitrate detection levels based on data by Edinburgh iGEM team 2009 [1]
Short Description: Coding sequence for NarL protein in accordance with BioBrick assembly 10 standards
Sequence:
gaattcgcggccgcttctagATGAGTAATCAGGAACCGGCTACTATCCTGCTGATTGACGATCACCCGATGCTGCGAACTGGCGTAAAACAGCTTATCAGTATGGCACCAGATATCACCGTGGTTGGCGAAGCGAGTAATGGCGAACAGGGTATTGAACT GGCGGAGTCTCTTGATCCCGATCTGATCCTGTTAGATCTCAATATGCCCGGCATGAACGGTCTGGAAACG CTGGATAAACTGCGCGAAAAGTCCCTCTCAGGGCGCATTGTGGTATTCAGCGTCTCTAACCATGAAGAAG ATGTGGTCACCGCACTGAAACGCGGCGCGGATGGCTATCTGTTAAAAGATATGGAACCGGAAGATCTGCT GAAAGCATTGCATCAGGCAGCTGCTGGCGAAATGGTATTAAGCGAAGCATTAACGCCTGTTCTGGCCGCC AGCTTGCGCGCTAACCGTGCCACTACTGAGCGCGATGTTAACCAGTTAACCCCACGCGAGCGCGATATTC TCAAGCTGATTGCCCAGGGTTTGCCGAACAAGATGATTGCCCGCCGCCTGGATATCACCGAAAGCACAGT AAAAGTGCACGTCAAGCACATGCTGAAGAAAATGAAGCTCAAGTCTCGCGTGGAAGCAGCGGTATGGGTG CATCAGGAGCGCATTTTCTAAtactagtagcggccgctgcag
Natural NarL sequence did not contain any EcoRI, PstI, SpeI, or XbaI restriction sites. NarL part is therefore usable by BioBrick Assmebly 10 standards.
References:
Stewart, V., H. Lin, P. Bledsoe. 2007. Activation of yeaR-yoaG Operon Transcription by the Nitrate-Responsive Regulator NarL Is Independent of Oxygen-Responsive Regulator Fnr in Escherichia coli K-12. J. Bacteriol. 189: 7539 - 7548
Stewart, V., R. S. Rabin 1993. Dual Response Regulators (NarL and NarP) Interact with Dual Sensors (NarX and NarQ) To Control Nitrate - and Nitrite - Regulated Gene Expression in Escherichia coli K-12. J. Bacteriol. 175: 3259 - 3268