Stanford/BIOE44:Module3:Day2:nitrate II

Nitrate Sensor Project II

Authors: Daniel Bui and Aaditya Shidham

Created BioBrick Parts: BBa_M33001, BBa_M33002

System Description: We plan to develop a system that can sense a low level of nitrate in water by using a mutant, nitrate-inducible fnr coupled with the narG promoter. While normally only inducible under anaerobic conditions, a single silent mutation to convert leucine-28 to histidine can allow the fnr gene to operate under aerobic conditions. The fnr gene acts as an activator on narG binding sites, which can send a PoPs-out signal to an RFP reporter. Previous studies have shown that the mutated form of fnr can sense nitrate at as low as 0.1 uM.

__________________________________________________________________________

Parts

narGp (BBa_M33001) sequence:

GAATTCGCGGCCGCTTCTAGAGATCCTAAAGGGGTATCTTAGGAATTTACTTTATTTTTCATCCCC ATCACTCTTGATCGTTATCAATTCCCACGCTGTTTCAGAGCGTTACCTTGCCCTTAAACATTAGCA ATGTCGATTTATCAGAGGGCCGACAGGCTCCCACTACTAGTAGCGGCCGCTGCAG

Short Description: Promoter designed to express downstream coding region only in the presence of nitrate and Fnr protein. This part is in accordance with Assembly Standard 10.

Long Description: The narG promoter is located at the beginning the nar operon and is naturally activated during nitrogen respiration of E. Coli by the Fnr protein to signal reduction of nitrate to nitrite. In the presence of nitrate, Fnr protein binds to a region upstream of narGp to act as an activator.

fnr (BBa_M33001) sequence:

GAATTCGCGGCCGCTTCTAG ATGATCCCGGAAAAGCGAATTATACGGCGCATTCAGTCTGGCGGTTGTGCTATCCATTGCCAGGATTGC AGCATCAGCCAGCATTGCATCCCGTTCACACTCAACGAACATGAGCTTGATCAGCTTGATAATATCATT GAGCGGAAGAAGCCTATTCAGAAAGGCCAGACGCTGTTTAAGGCTGGTGATGAACTTAAATCGCTTTAT GCCATCCGCTCCGGTACGATTAAAAGTTATACCATCACTGAGCAAGGCGACGAGCAAATCACTGGTTTC CATTTAGCAGGCGACCTGGTGGGATTTGACGCCATCGGCAGCGGCCATCACCCGAGCTTCGCGCAGGCG CTGGAAACCTCGATGGTATGTGAAATCCCGTTCGAAACGCTGGACGATTTGTCCGGTAAAATGCCGAAT CTGCGTCAGCAGATGATGCGTCTGATGAGCGGTGAAATCAAAGGCGATCAGGACATGATCCTGCTGTTG TCGAAGAAAAATGCCGAGGAACGTCTGGCTGCATTCATCTACAACCTGTCCCGTCGTTTTGCCCAACGC GGCTTCTCCCCTCGTGAGTTCCGCCTGACGATGACTCGTGGCGATATCGGTAACTATCTGGGCCTGACG GTAGAAACCATCAGCCGTCTGCTGGGTCGCTTCCAGAAAAGCGGCATGCTGGCAGTCAAAGGTAAATAC ATCACCATCGAAAATAACGATGCGCTGGCCCAGCTTGCTGGTCATACGCGTAACGTTGCCTAATAA TACTAGTAGCGGCCGCTGCAG

Short Description: Coding sequence for Fnr-LH28 protein, an activator for the nar operon in the presence of nitrate. This part is in accordance with Assembly Standard 10.

Long Description: The fnr gene naturally is activated under anaerobic conditions during E. coli nitrogen respiration. The part above contains a single missense LH28 mutation to allow it to operate under aerobic conditions. Cytoplasmic Fnr-LH28 protein created by the gene can bind to a regulatory region upstream of the nar operon as an activator, facilitating the reduction of nitrate to nitrite.

__________________________________________________________________________

References

1. Bates, D. M., C. V. Popescu, N. Khoroshilova, K. Vogt, H. Beinert, E. Munck, and P. J. Kiley. Substitution of Leucine 28 with Histidine in the Escherichia coli Transcription Factor FNR Results in Increased Stability of the [4Fe-4S]2+ Cluster to Oxygen J. Biol. Chem. 2000 275: 6234-6240.

2. DeAngelis, K. M., P. S. Ji, M. K. Firestone, and S. E. Lindow. 2005. Two novel bacterial biosensors for detection of nitrate availability in the rhizosphere. Appl. Environ. Microbiol. 71:8537-8547

3. Jayaraman, P. S., T. C. Peakman, S. J. Busby, R. V. Quincey, and J. A. Cole. 1987. Location and sequence of the promoter of the gene for the NADH-dependent nitrite reductase of Escherichia coli and its regulation by oxygen, the Fnr protein and nitrite. J. Mol. Biol. 196:781-788.

4. Shaw, Duncan. "Nndeotide seqaence of the fnr gene and primary structure of the Fnr protein of Eschertchla coli." Nucleic Acids Research 10.19 (1982): 6119-6130. Web.