Stanford/BIOE44:Module3:Day2:nitrate II: Difference between revisions
Daniel Bui (talk | contribs) No edit summary |
Daniel Bui (talk | contribs) No edit summary |
||
Line 10: | Line 10: | ||
'''Created BioBrick Parts:''' BBa_M33001, BBa_M33002 | '''Created BioBrick Parts:''' BBa_M33001, BBa_M33002 | ||
System Description: We plan to develop a system that can sense a low level of nitrate in water by using a mutant, nitrate-inducible fnr coupled with the narG promoter. While normally only inducible under anaerobic conditions, a single silent mutation to convert leucine-28 to histidine can allow the fnr gene to operate under aerobic conditions. The fnr gene acts as an activator on narG binding sites, which can send a PoPs-out signal to an RFP reporter. Previous studies have shown that the mutated form of fnr can sense nitrate at as low as 0.1 uM. | '''System Description''': We plan to develop a system that can sense a low level of nitrate in water by using a mutant, nitrate-inducible fnr coupled with the narG promoter. While normally only inducible under anaerobic conditions, a single silent mutation to convert leucine-28 to histidine can allow the fnr gene to operate under aerobic conditions. The fnr gene acts as an activator on narG binding sites, which can send a PoPs-out signal to an RFP reporter. Previous studies have shown that the mutated form of fnr can sense nitrate at as low as 0.1 uM. | ||
__________________________________________________________________________ | __________________________________________________________________________ | ||
Line 22: | Line 22: | ||
ATGTCGATTTATCAGAGGGCCGACAGGCTCCCACTACTAGTAGCGGCCGCTGCAG | ATGTCGATTTATCAGAGGGCCGACAGGCTCCCACTACTAGTAGCGGCCGCTGCAG | ||
Short Description: Promoter designed to express downstream coding region only in the presence of nitrate and Fnr protein. This part is in accordance with Assembly Standard 10. | '''Short Description:''' Promoter designed to express downstream coding region only in the presence of nitrate and Fnr protein. This part is in accordance with Assembly Standard 10. | ||
Long Description: The narG promoter is located at the beginning the nar operon and is naturally activated during nitrogen respiration of ''E. Coli'' by the Fnr protein to signal reduction of nitrate to nitrite. In the presence of nitrate, Fnr protein binds to a region upstream of narGp to act as an activator. | '''Long Description:''' The narG promoter is located at the beginning the nar operon and is naturally activated during nitrogen respiration of ''E. Coli'' by the Fnr protein to signal reduction of nitrate to nitrite. In the presence of nitrate, Fnr protein binds to a region upstream of narGp to act as an activator. | ||
Line 43: | Line 43: | ||
TACTAGTAGCGGCCGCTGCAG | TACTAGTAGCGGCCGCTGCAG | ||
Short Description: Coding sequence for Fnr-LH28 protein, an activator for the nar operon in the presence of nitrate. This part is in accordance with Assembly Standard 10. | '''Short Description''': Coding sequence for Fnr-LH28 protein, an activator for the nar operon in the presence of nitrate. This part is in accordance with Assembly Standard 10. | ||
Long Description: The fnr gene naturally is activated under anaerobic conditions during ''E. coli'' nitrogen respiration. The part above contains a single missense LH28 mutation to allow it to operate under aerobic conditions. Cytoplasmic Fnr-LH28 protein created by the gene can bind to a regulatory region upstream of the nar operon as an activator, facilitating the reduction of nitrate to nitrite. | '''Long Description''': The fnr gene naturally is activated under anaerobic conditions during ''E. coli'' nitrogen respiration. The part above contains a single missense LH28 mutation to allow it to operate under aerobic conditions. Cytoplasmic Fnr-LH28 protein created by the gene can bind to a regulatory region upstream of the nar operon as an activator, facilitating the reduction of nitrate to nitrite. | ||
__________________________________________________________________________ | __________________________________________________________________________ |
Revision as of 20:49, 29 May 2010
Nitrate Sensor Project II
Authors: Daniel Bui and Aaditya Shidham
Created BioBrick Parts: BBa_M33001, BBa_M33002
System Description: We plan to develop a system that can sense a low level of nitrate in water by using a mutant, nitrate-inducible fnr coupled with the narG promoter. While normally only inducible under anaerobic conditions, a single silent mutation to convert leucine-28 to histidine can allow the fnr gene to operate under aerobic conditions. The fnr gene acts as an activator on narG binding sites, which can send a PoPs-out signal to an RFP reporter. Previous studies have shown that the mutated form of fnr can sense nitrate at as low as 0.1 uM.
__________________________________________________________________________
Parts
narGp (BBa_M33001) sequence:
GAATTCGCGGCCGCTTCTAGAGATCCTAAAGGGGTATCTTAGGAATTTACTTTATTTTTCATCCCC ATCACTCTTGATCGTTATCAATTCCCACGCTGTTTCAGAGCGTTACCTTGCCCTTAAACATTAGCA ATGTCGATTTATCAGAGGGCCGACAGGCTCCCACTACTAGTAGCGGCCGCTGCAG
Short Description: Promoter designed to express downstream coding region only in the presence of nitrate and Fnr protein. This part is in accordance with Assembly Standard 10.
Long Description: The narG promoter is located at the beginning the nar operon and is naturally activated during nitrogen respiration of E. Coli by the Fnr protein to signal reduction of nitrate to nitrite. In the presence of nitrate, Fnr protein binds to a region upstream of narGp to act as an activator.
fnr (BBa_M33001) sequence:
GAATTCGCGGCCGCTTCTAG ATGATCCCGGAAAAGCGAATTATACGGCGCATTCAGTCTGGCGGTTGTGCTATCCATTGCCAGGATTGC AGCATCAGCCAGCATTGCATCCCGTTCACACTCAACGAACATGAGCTTGATCAGCTTGATAATATCATT GAGCGGAAGAAGCCTATTCAGAAAGGCCAGACGCTGTTTAAGGCTGGTGATGAACTTAAATCGCTTTAT GCCATCCGCTCCGGTACGATTAAAAGTTATACCATCACTGAGCAAGGCGACGAGCAAATCACTGGTTTC CATTTAGCAGGCGACCTGGTGGGATTTGACGCCATCGGCAGCGGCCATCACCCGAGCTTCGCGCAGGCG CTGGAAACCTCGATGGTATGTGAAATCCCGTTCGAAACGCTGGACGATTTGTCCGGTAAAATGCCGAAT CTGCGTCAGCAGATGATGCGTCTGATGAGCGGTGAAATCAAAGGCGATCAGGACATGATCCTGCTGTTG TCGAAGAAAAATGCCGAGGAACGTCTGGCTGCATTCATCTACAACCTGTCCCGTCGTTTTGCCCAACGC GGCTTCTCCCCTCGTGAGTTCCGCCTGACGATGACTCGTGGCGATATCGGTAACTATCTGGGCCTGACG GTAGAAACCATCAGCCGTCTGCTGGGTCGCTTCCAGAAAAGCGGCATGCTGGCAGTCAAAGGTAAATAC ATCACCATCGAAAATAACGATGCGCTGGCCCAGCTTGCTGGTCATACGCGTAACGTTGCCTAATAA TACTAGTAGCGGCCGCTGCAG
Short Description: Coding sequence for Fnr-LH28 protein, an activator for the nar operon in the presence of nitrate. This part is in accordance with Assembly Standard 10.
Long Description: The fnr gene naturally is activated under anaerobic conditions during E. coli nitrogen respiration. The part above contains a single missense LH28 mutation to allow it to operate under aerobic conditions. Cytoplasmic Fnr-LH28 protein created by the gene can bind to a regulatory region upstream of the nar operon as an activator, facilitating the reduction of nitrate to nitrite.
__________________________________________________________________________
References
1. Bates, D. M., C. V. Popescu, N. Khoroshilova, K. Vogt, H. Beinert, E. Munck, and P. J. Kiley. Substitution of Leucine 28 with Histidine in the Escherichia coli Transcription Factor FNR Results in Increased Stability of the [4Fe-4S]2+ Cluster to Oxygen J. Biol. Chem. 2000 275: 6234-6240.
2. DeAngelis, K. M., P. S. Ji, M. K. Firestone, and S. E. Lindow. 2005. Two novel bacterial biosensors for detection of nitrate availability in the rhizosphere. Appl. Environ. Microbiol. 71:8537-8547
3. Jayaraman, P. S., T. C. Peakman, S. J. Busby, R. V. Quincey, and J. A. Cole. 1987. Location and sequence of the promoter of the gene for the NADH-dependent nitrite reductase of Escherichia coli and its regulation by oxygen, the Fnr protein and nitrite. J. Mol. Biol. 196:781-788.
4. Shaw, Duncan. "Nndeotide seqaence of the fnr gene and primary structure of the Fnr protein of Eschertchla coli." Nucleic Acids Research 10.19 (1982): 6119-6130. Web.