Stanford/BIOE44:Module 5:Day1

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Primer Designs)
Current revision (00:45, 20 May 2010) (view source)
(Primer Designs)
Line 261: Line 261:
<span style="background:#FF00FF">TTAAGGAGGTAAAAAAA</span>
<span style="background:#FF00FF">TTAAGGAGGTAAAAAAA</span>
<span style="background:#00FF00">ATGAAACATTCTTCCGATATCTGCATTGTTG</span>
<span style="background:#00FF00">ATGAAACATTCTTCCGATATCTGCATTGTTG</span>

Current revision

Home        People        Schedule        Key Info.        OWW Basics       
DNA Engineering        Devices        Synthesis        Baking        Testing


M5: Day 1

Getting ready for parts to arrive

Parts Request

YOU MUST MAKE YOUR FINAL PARTS REQUESTS ASAP Please fill in this google doc with the information on the parts you need. In case there is overlap on the parts different groups need, there is a column for "other groups that need this part." Please fill this column in so we know how much of each part we need to make. Even if you are using a part that you think we already have, you should make a formal request.

RBS Design

A nice discussion of | RBS design can be found here.


Primer Design Guidelines

  • Homology region should be about 20bp.
  • Total length should be less than 100bp (it is not possible to order one longer than 100bp). Longer primers take longer to be made, so make your primers as short as possible.
  • If you cannot make your promoter+rbs+cds less than or equal to 100bp, then you need to plan on doing a double ligation.
  • You should include a spacer between your RBS and the beginning of your coding sequence. It should be 6-12bp (and in frame). The scar sequence is convenient for this purpose.
  • It is also probably a good idea to put a spacer sequence between the promoter and RBS.
  • You don't need to include the entire prefix or suffix if you are planning on cutting at one of the inner sites (XbaI or SpeI)

Example Primer design

  • Blue = Biobrick prefix or suffix
  • Pink = Ribosome binding site
  • Green = gene sequence (aka homology region)
  • Yellow = Promoter

Adding a ribosome binding site



Adding a promoter and a ribosome binding site



Primer Designs

Chris & Karina:


merR Reverse Primer: 5'- ctgcagcggccgctactagtaTTACTAGACCCTGGAGCGTG -3'

Daniel & Aaditya:

1) fnrNatural forward primer:





- 3'

2) fnrSynthetic forward primer

5' -





- 3'

3) Generic fnr reverse primer

5' -


- 3'

Scott & Travis: Coding region w/ promoter J23106 (medium) and biobrick parts,




Frank, Claire, Sanjay (FCS):

(1) arsR forward primer (64 bp):


(2) B0030 - arsR reverse primer (53 bp):


(3) J23101 - B0030 - arsR reverse primer (96 bp):

5' GTTTCTTC TACTAGTA tttacagctagctcagtcctaggtattatgctagc ctctagta attaaagaggagaaa tactag ATGCGGGCACAGCGGC 3'

(4) J23101 - B0034 - glnK forward primer (99 bp):

5' ATA TTCTAGAG tttacagctagctcagtcctaggtattatgctagc tactaga aaagaggagaaa tactag ATGAAGCTAGTCACAGCCATCATCAAGC 3'

(5) glnK reverse primer (96 bp):


Sunny & Alex:

1) Part 5:

Forward Primer (Prefix + RBS + todS)







-3' (78bp)

Reverse primer (Suffix + todS):





-3' (58bp)

2) Part 6

Forward Primer (Prefix + RBS + todT):







-3' (78bp)

Reverse primer (Suffix + todT):





-3' (59bp)

3) Part 3

Forward Primer (Prefix + Promoter + RBS + todS):









-3' (99bp)

Reverse primer (Suffix + todS):





-3' (58bp)

4) Part 4

Forward Primer (Prefix + Promoter + RBS + CG (BBa_K274002)):

5'- ATA






-3' (99bp)

Reverse primer (Suffix + CG):





-3' (58bp)

I'm Moss-ay

To do list for Tuesday (5/18):

  • Finish the Moss Datasheet. Remember we're trying to make a sheet that someone could look at and understand why moss is a useful organism, what you would use it for and how. It needs to include more than what we've done in the class.
  • Make BCD liquid media with mannitol.
  • Look at our plates.

pSB4A2 troubleshooting

pSB4A5 gel
Personal tools