Swartz:Protocols/otDNA: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
(New page: HH-otDNA: GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC''CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGC'''GCT'''GGTTCAAATCCG'''GCC'''CGCCGGACCA'' HH-...) |
(No difference)
|
Revision as of 15:44, 29 May 2012
HH-otDNA:
GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCGCTGGTTCAAATCCGGCCCGCCGGACCA
HH-otDNAOpt:
GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCAGGGGTTCAAATCCCCTCCGCCGGACCA
- Italics: o-tDNA Sequence
- Bold: Regions that have been mutated in o-tDNAOpt for better interaction with E. coli EfTu. (as per Young et al. 2010, J Mol Biol)
- Amplify the second sequence from pY71 HH-otDNAOpt plasmid using short end primers and house-made Pfu.
- Check on 1% w/v agarose gel to make sure that the linear template is the only product.
- Ethanol precipitate the nucleic acids in the solution (no PCR cleanup required):
- Add enough EDTA to obtain a concentration of 20 mM. EDTA is required to chelate Mg2+.
- Then, add enough sodium acetate (pH 5.5) to a final concentration of 300 mM.
- To this mixture, add 3 volumes of ethanol.
- Incubate on ice for 15-30 minutes.
- Resuspend the pellet in a buffer of choice. I used 10 mM Bis-Tris, pH 7.4.
- Measure [tDNA template] using Qubit assay.
- Titrate different amounts of the template to determine how much is required for your particular protein.