Swartz:Protocols/otDNA

HH-otDNA:

GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCGCTGGTTCAAATCCGGCCCGCCGGACCA

HH-otDNAOpt:

GCTTTTAGATCTTAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCCCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCAGGGGTTCAAATCCCCTCCGCCGGACCA

Italics: o-tDNA Sequence

Bold: Regions that have been mutated in o-tDNAOpt for better interaction with E. coli EfTu. (as per Young et al. 2010, J Mol Biol)

1. Amplify the second sequence from pY71 HH-otDNAOpt plasmid using short end primers and house-made Pfu.
2. Check on 1% w/v agarose gel to make sure that the linear template is the only product.
3. Ethanol precipitate the nucleic acids in the solution (no PCR cleanup required):

   Add enough EDTA to obtain a concentration of 20 mM. EDTA is required to chelate Mg2+.

   Then, add enough sodium acetate (pH 5.5) to a final concentration of 300 mM.

   To this mixture, add 3 volumes of ethanol.

   Incubate on ice for 15-30 minutes.

4. Resuspend the pellet in a buffer of choice. I used 10 mM Bis-Tris, pH 7.4.
5. Measure [tDNA template] using Qubit assay.
6. Titrate different amounts of the template to determine how much is required for your particular protein.