Talk:20.109(S11):Complete DNA design (Day2): Difference between revisions
Anirudh Arun (talk | contribs) (→W/F) |
Anirudh Arun (talk | contribs) (→W/F) |
||
Line 64: | Line 64: | ||
|- | |- | ||
|Yellow | |Yellow | ||
| | |5’CCGGGTAAGCACCTGTGGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGG3’ | ||
3’CATTCGTGGACACCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAG5’ | |||
|We chose to modify both the lambda -10 region and the lux box of the hybrid promoter. We modified our -10 region the same as TR Orange (GATA –> GTTG) to reduce the basal expression level. We determined from a primary source that modification of A7 to guanine yields ~25% reduction in promoter activity. Anticipating the reduced ability of cI protein product to repress in the aforemention -10 region, we are also reducing the activity of the lux box as compensation. | |We chose to modify both the lambda -10 region and the lux box of the hybrid promoter. We modified our -10 region the same as TR Orange (GATA –> GTTG) to reduce the basal expression level. We determined from a primary source that modification of A7 to guanine yields ~25% reduction in promoter activity. Anticipating the reduced ability of cI protein product to repress in the aforemention -10 region, we are also reducing the activity of the lux box as compensation. | ||
|- | |- |
Revision as of 12:28, 11 March 2011
High-level designs and implementation with primers
T/R
Group | Forward primer; <br>Reverse primer | Summary of approach | ||
---|---|---|---|---|
Blue | 5’CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGTTTTACCTCTGGCGGTGATAGGG3’ 5’GATCCCCTATCACCGCCAGAGGTAAAACAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3’ |
The Plux-lamda promoter may be leaky due to the high basal expression of the Pr promoter. We are deleting part of the -35 region (after Or2) in the Pr promoter and adding 2 G's in the middle of -10 region (right after Or1) in order to reduce the strength of the promoter and decrease the AT richness in the sequence. | ||
Pink | 5'CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATACCTCTGGCGGTGATATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAGGATCC3' 5'AAATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATATCACCGCCAGAGGTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3' |
We are inserting a second copy of the Or1 sequence directly infront of Or2 to hopefully improve repressing of the operons | ||
Green | 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCCCCTAACACCGTGCGTGTTGCCCCTTTTACCTCTGGCGGTGATACCGGATCC3’ 3'GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGGGGATTGTGGCACGCACAACGGGGAAAATGGAGACCGCCACTATGGCCTAGG5' |
We are substituting all -10 and -35 regions in the Or1 and Or2 regions to C's. This way, frameshift mutations can be prevented. They also avoid the restrict enzyme interference. | ||
Yellow | 5' CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTTGCTATTTTTACCTCTGGCGGTGATATTGGATCC 3'
5’GGATCCAATATCACCGCCAGAGGTAAAAATAGCAAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG 3’ |
We decided to change 2 nucleotides in the -35 region of P(R), and 1 nucleotide in the -10 region. We also added an extra basepair to between these two regions, increasing its length. These changes make the promoter less ideal of a binding site, therefore making it a weaker promoter. We chose the changes in nucleotides based on the lac promoter consensus sequence. | ||
Red | 5'CCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGGGTGGCACCGTGCGTGGCACTGGTTTTACCTCTGGCGGTGATAG3'
5'GATCCTATCACCGCCAGAGGTAAAACCAGCGACACGCACGGTGCCACCCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTAC3' |
We decided to drastically mutate the -10 and -35 sequences located inside of the Or2 operator in hopes of weakening the promoter without significantly weakening the repressor binding. We made these sequences g and c rich since they are usually t and a rich. | ||
Purple | 5’CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTAGGGTACCTCTGGCGGTGATAGGATCC3’ 5'GGATCCTATCACCGCCAGAGGTAAAATAGTCAACACGCACGGTGTTATTCGACTATAACAAACCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTACCCGGG3’ |
We are substituting the TTT base pair sequence between OR1 and OR2 regions to GGG. This way, we can avoid changing the OR1 and OR2 while changing the promoter region and possibly reducing its activation level. Because bacteria promoters are often rich in A's and T's, we chose to change the TTT to GGG. | ||
Orange | updated sequences:
sense strand: 5’-CCCGGGTAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGGGATCC – 3’ complement: 3’-GGGCCCATTCGTGGACATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAGG – 5’ |
design rationale:
to reduce the strength of the promoter, we decided that the best candidate regions to alter would be the -35 and -10 upstream regulatory regions. Since altering more than 1 region at a time could have confusing effects (i.e. it gets harder to detect which change caused what effect), we decided to finally just change the -10 region, as it would have a more pronounced effect (since it is closer to the promoter). The -10 region has bases GATA. We wanted to replace these 4 bases, and also ensure that our new sequence was not similar to the consensus sequences. We were also curious to know what might happen if we used the last 4 bases of the OR2 region instead of these 4 bases, since these 4 happen to be the last 4 bases of the OR1 region. Thus, we ended up replacing the GATA by GTTG. |
W/F
Group | Forward primer; <br>Reverse primer | Summary of approach |
---|---|---|
Yellow | 5’CCGGGTAAGCACCTGTGGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGTTGG3’
3’CATTCGTGGACACCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTTATTGTGGCACGCACAACTGATAAAATGGAGACCGCCACAACCCTAG5’ |
We chose to modify both the lambda -10 region and the lux box of the hybrid promoter. We modified our -10 region the same as TR Orange (GATA –> GTTG) to reduce the basal expression level. We determined from a primary source that modification of A7 to guanine yields ~25% reduction in promoter activity. Anticipating the reduced ability of cI protein product to repress in the aforemention -10 region, we are also reducing the activity of the lux box as compensation. |