Talk:20.109(S08):Start-up protein engineering (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(WF lab)
(WF lab)
Line 69: Line 69:
|GATGGGAACGGCTACATCACCGCTGCTCAG
|GATGGGAACGGCTACATCACCGCTGCTCAG
|-
|-
-
|
+
|BLUE
-
|
+
|N60->E
-
|
+
|GATGCTGATGGCGAAGGAACGATTTAC
-
|
+
|N60->K
-
|
+
|GATGCTGATGGCAAGGGAACGATTTAC
|-
|-
|
|

Revision as of 16:41, 12 March 2008

TR lab

Team colour Mutant 1 Primer 1 (forward) Mutant 2 Primer 2 (forward)
Red D133R GGGAAGCAGATATCGATGGTCGTGGCCAAGTAAACTATGAAG D133W GGGAAGCAGATATCGATGGTTGGGGCCAAGTAAACTATGAAGAG
Purple Y64P GCTGATGGCAATGGAACGATTCCCTTTCCTGAATTTCTTACTATG Y64K GCTGATGGCAATGGAACGATTAAGTTTCCTGAATTTCTTACTATG
Blue G98D GACAAGGATGGGAACGACTACATCAGCGCTGCTCAGTTACGTC G98P GACAAGGATGGGAACCCCTACATCAGCGCTGCTCAGTTACGTC
Pink G96D CGTGTTTTTGACAAGGATGACAACGGCTACATCAGCGCTGC G96K GTTTTTGACAAGGATAAGAACGGCTACATCAGCGCTGCTCAG
Yellow T28D CGACAAGGATGGGGACGGCACCATCGACACAAAGGAAC T28R GATGGGGACGGCACCATCAGGACAAAGGAACTTGGCACCG
Green Y64D GGCAATGGAACGATTGACTTTCCTGAATTTCTGACTATGATGGC Y64H GGCAATGGAACGATTCACTTTCCTGAATTTCTCACTATGATGGC


WF lab

Team colour Mutant 1 Primer 1 (forward) Mutant 2 Primer 2 (forward
PINK D56->P CTTCTCATTATTCCCCAAGGATGGGGACGGCACCATCACC D56->R CTTCTCATTATTCCGCAAGGATGGGGACGGCACCATCACC
PURPLE S101->L GATGGGAACGGCTACATCCTCGCTGCTCAG S101->T GATGGGAACGGCTACATCACCGCTGCTCAG
BLUE N60->E GATGCTGATGGCGAAGGAACGATTTAC N60->K GATGCTGATGGCAAGGGAACGATTTAC
GREEN K92->H gcattccgtgtttttgacCACgatgggaacggctacatcagcgct K92->A gcattccgtgtttttgacGGGgatgggaacggctacatcagcgct
Personal tools