Talk:20.109(S13):Context-setting and primer design (Day1)

From OpenWetWare

Revision as of 16:24, 13 February 2013 by Maria A. Escobar (Talk | contribs)
Jump to: navigation, search

Contents

T/R section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Grey (Platinum) :) CAT GCT TGC CAA CAC AG GAA TGG TCT GGT TGC TTC bp 9 bp 251 E. Hellem: polar tube protein gene
Green AGG TTG ATT CTG CCT GAC CGG AAC CAA ACC CTG AT bp 5 bp 236 VC: SSU rRNA
Pink ttctgcctgacgtagatg cctctccggaaccaaac bp 12 bp 226 VC
Yellow CTGACGTGGATGCTATTC CCGTCAACCGTCACTGTC bp 18 bp 199 VC small subunit ribosomal RNA gene


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple 5' GCG ATG ATT TAG TCT GGC 3' 5’ CAA TTT CCA ACG ACC ATG C 3’ bp 93, F bp 879, R VC, SSU rRNA
Red GGT TGA TTC TGC CTG ACG TGG CCT TCG TCC TTC ATC ACC ACA A bp 6, F bp 588, R VC, SSU RNA
Orange 5'cgt agt cat aga agg gca aag ag3' 5' ctc tct ctc tac ctg cta ttg ta 3' 441 1005 V. corneae TV4/TV5 SSU rRNA
Blue CCGCAATCAGGGACGAA GTCAACGTCACTGTCTTGG 60 195 V. corneae TV4/TV5 SSU rRNA


W/F section

Please sign up for one of the design challenges -- four teams per challenge -- right away.

When you have finished, post your primer sequences (from 5' to 3') so that they can be ordered.

I will name your primers by the approximate base-pair that they target in V corneae or E hellem, so please share this information as well.

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Purple 5' GGA CGG CTC AGT GAT AG 3'
Yellow 5' GAGAAGTAAGATGTTTAGCAAGTAT 3' 5' CATCACCACAAAAGTCCAA 3' bp 359, F bp 630, R EH, SSU rRNA
Red 5' CCA GGT TGA TTC TGC CTG 3' 5' CTC TCC GGA ACC AAA CC 3' bp 9, F bp 225, R VC, SSU, rRNA
Platinum 5' CAT GTT GAT TCT GCC TGA C 3' 5' CTC TCC TGA ACC AAA CCC TG 3' bp 4, F bp 278, R EH, SSU rRNA


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink TTCTGCCTGACGTAGATG TCAACCGTCACTGTCTTG bp 12 bp 213 for VC TV4 SSU rRNA
Green AATCAGGGACGAATAGCTC TGATAGTCCTGCGTCTTATTC bp 64 bp 169 VC SSU rRNA, full sequence
Orange CTGCCTGACGTAGATGCTAG CTGTCTTGGTAGTCCACTAC bp 14 bp 203 VC TV4 SSU rRNA gene
Blue ACGAGCAATACAGGAGTGG TCCATCTGAGCACCTTCC bp 841 bp 1049 VC SSU rRNA


Personal tools