Talk:20.109(S14):Diagnostic primer design (Day2)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Sensitivity)
Line 84: Line 84:
|-
|-
|Pink
|Pink
-
|
+
|Orange
|  
|  
|  
|  

Revision as of 14:12, 12 February 2014

Contents

T/R Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red CAC CAG GTT GAT ACT GCC TGA C CCT ATC CCG AAC CAA ACC CTG bp 1 bp 260 EH, SSU rRNA
Green
Pink ACC AGG TTG ATT CTG CCT GAC TCT CTC ACG CTC CCT CTC C bp1/bp2 bp252/bp290 EH/VC SSU rRna


Specificity

Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Yellow
Blue GATTCTGCCTGACGTAGATGC CTGCTGGCACCAAACTTGC 10 bp 408 bp E. hellem (AF118143)
Orange


W/F Section

Sensitivity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Pink Orange
Red


Specificity

Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
White


Personal tools