Talk:20.109(S14):Diagnostic primer design (Day2)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 97: Line 97:
|VC/EH small subunit rRNA
|VC/EH small subunit rRNA
|Orange (Final)

Revision as of 17:41, 16 February 2014


T/R Section


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?


Team Color Forward primer Reverse primer Target site (e.g. bp 60), F Target side (e.g., bp 300), R Is bp # for VC or EH? Which gene?

W/F Section


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Red ACC AGG TTG ATT CTG CCT GAC ATA TTA CCG CGG CTG CTG bp 1/2 bp 380/421 VC/EH small subunit rRNA


Team color Forward (F) primer Reverse (R) primer Target site (e.g. bp 60), F Target site (e.g., bp 300), R Is bp # for VC or EH? Which gene?
Blue (final) CAC CAG GTT GAT TCT GCC TGA C CTG CTG GCA CCA GAC TTG C 1 426 for EH; 386 for VC Both. SSU rRNA
Green agattgctcccacgtccaag caacgaccatgcaccactc 251 872 VC

Personal tools