Talk:E. coli genotypes

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (20:45, 4 March 2013) (view source)
(W3110 derived E.coli K-12 strains)
Line 14: Line 14:
==W3110 derived E.coli K-12 strains==
==W3110 derived E.coli K-12 strains==
* W3110 (λ857S7) - phenotype (essentially the same as W3110): F<sup>+</sup> &lambda;<sup>-</sup> rph-1 INV(rrnD, rrnE) -[[User:Etienne_Robillard|ER]]
* W3110 (λ857S7) - phenotype (essentially the same as W3110): F<sup>+</sup> &lambda;<sup>-</sup> rph-1 INV(rrnD, rrnE) -[[User:Etienne_Robillard|ER]]
* LuxR (EG10269) : a pyrimidine-starved K-12/MG1655 acceptable chassis/strain for E. coli ? -[[User:Etienne_Robillard|ER]]
* LuxR (EG10269): a pyrimidine-starved K-12/MG1655 acceptable chassis/strain for E. coli ? -[[User:Etienne_Robillard|ER]]
** To visualize the pathways of W3110 derived substrains, examine the annotated data [ here], [ here], and [ here].
** To visualize the pathways of W3110 derived substrains, examine the annotated data [ here], [ here], and [ here].
** Inter-species hybridation of W3110 derived products inserts onto H. sapiens genome may be examined and validated [ here] in the study of the histidine kinase enzyme (EC

Current revision

  • I would like to know if there are specific genotypes that are temperature sensitive double suppressor mutants. Could anyone with an idea of such a strain please contact me at --Harrys
    • Hi Harrys, what phenotypes are you trying to supress? Amber & Ochre? And also, temperature sensitive with respect to what protein/phenotype? Thanks for the clarification. --10:27, 6 Dec 2005 (EST)

Assessing lacI genotypes

On this page there are several notes regarding the lac operon genotype of certain strains by User:Austin J. Che and User:Reshma P. Shetty. These tests were done via colony PCR of the respective strain using two primers. One primer near the end mhpR (5' gagggttacggacagaactac 3') and the other upstream in lacI (5' CACAGCAATGGCATCCTGGTC 3'). Sequencing of this PCR product provides the sequence of the promoter driving lacI expression and can provide some indication of whether lacI is present in the strain. (Note that these primers may not be appropriate for determining lacI genotype on F plasmids.)

The Novagen Strain Manual

Bill Flanagan ( at MIT) 15:26, 19 May 2009 (EDT)

W3110 derived E.coli K-12 strains

  • W3110 (λ857S7) - phenotype (essentially the same as W3110): F+ λ- rph-1 INV(rrnD, rrnE) -ER
  • LuxR (EG10269): a pyrimidine-starved K-12/MG1655 acceptable chassis/strain for E. coli ? -ER
    • To visualize the pathways of W3110 derived substrains, examine the annotated data here, here, and here.
    • Inter-species hybridation of W3110 derived products inserts onto H. sapiens genome may be examined and validated here in the study of the histidine kinase enzyme (EC
Personal tools