Talk:E. coli genotypes: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
| Line 3: | Line 3: | ||
==Assessing lacI genotypes== | ==Assessing lacI genotypes== | ||
On this page there are several notes regarding the lac operon genotype of certain strains by [[User:Austin J. Che]] and [[User:Reshma P. Shetty]]. These tests were done via colony PCR of the respective strain using two primers. One primer near the end mhpR (<code>5' gagggttacggacagaactac 3'</code>) and the other upstream in lacI (<code>5' CACAGCAATGGCATCCTGGTC 3'</code>). Sequencing of this PCR product provides the sequence of the promoter driving lacI expression. (Note that these primers may not be appropriate for determining lacI genotype on F plasmids.) | On this page there are several notes regarding the lac operon genotype of certain strains by [[User:Austin J. Che]] and [[User:Reshma P. Shetty]]. These tests were done via colony PCR of the respective strain using two primers. One primer near the end mhpR (<code>5' gagggttacggacagaactac 3'</code>) and the other upstream in lacI (<code>5' CACAGCAATGGCATCCTGGTC 3'</code>). Sequencing of this PCR product provides the sequence of the promoter driving lacI expression and can provide some indication of whether lacI is present in the strain. (Note that these primers may not be appropriate for determining lacI genotype on F plasmids.) | ||
Revision as of 07:40, 19 June 2007
- I would like to know if there are specific genotypes that are temperature sensitive double suppressor mutants. Could anyone with an idea of such a strain please contact me at cjharrys@gmail.com --Harrys
- Hi Harrys, what phenotypes are you trying to supress? Amber & Ochre? And also, temperature sensitive with respect to what protein/phenotype? Thanks for the clarification. --10:27, 6 Dec 2005 (EST)
Assessing lacI genotypes
On this page there are several notes regarding the lac operon genotype of certain strains by User:Austin J. Che and User:Reshma P. Shetty. These tests were done via colony PCR of the respective strain using two primers. One primer near the end mhpR (5' gagggttacggacagaactac 3') and the other upstream in lacI (5' CACAGCAATGGCATCCTGGTC 3'). Sequencing of this PCR product provides the sequence of the promoter driving lacI expression and can provide some indication of whether lacI is present in the strain. (Note that these primers may not be appropriate for determining lacI genotype on F plasmids.)
