TdTomato

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (22:07, 18 March 2007) (view source)
 
(2 intermediate revisions not shown.)
Line 1: Line 1:
-
 
+
'''Sequence''' {{hide|
-
<showhide>'''Sequence'''__HIDER__
+
<nowiki>atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag
-
<hide>
+
-
atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag
+
ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
Line 25: Line 23:
aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc
aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc
aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc
aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc
-
gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa
+
gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa</nowiki>
-
</hide></showhide>
+
}}
 +
 
 +
==Reference==
 +
<biblio>
 +
#Tsien pmid=15558047
 +
</biblio>

Current revision

Sequence

atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatc cccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc gaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc tacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaag accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc atctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctg gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc gcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgc atggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccc tacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcc tgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgcc gacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatg aacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacg ctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcag aagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctg aagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttc aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa

Reference

  1. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, and Tsien RY. . pmid:15558047. PubMed HubMed [Tsien]
Personal tools