
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (21:07, 18 March 2007) (view source)
(2 intermediate revisions not shown.)
Line 1: Line 1:
'''Sequence''' {{hide|
Line 25: Line 23:
#Tsien pmid=15558047

Current revision


atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatc cccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc gaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc tacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaag accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc atctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctg gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc gcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgc atggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccc tacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcc tgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgcc gacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatg aacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacg ctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcag aagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctg aagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttc aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa


Error fetching PMID 15558047:
  1. Error fetching PMID 15558047: [Tsien]
Personal tools