TdTomato

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
<showhide>'''Sequence'''__HIDER__
<showhide>'''Sequence'''__HIDER__
<hide>
<hide>
-
atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag
+
<nowiki>atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag
ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
Line 24: Line 24:
aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc
aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc
aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc
aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc
-
gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa
+
gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa</nowiki>
</hide></showhide>
</hide></showhide>

Revision as of 19:33, 30 May 2006

<showhide>Sequence__HIDER__ <hide> atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatc cccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc gaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc tacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaag accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc atctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctg gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc gcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgc atggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccc tacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcc tgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgcc gacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatg aacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacg ctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcag aagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctg aagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttc aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa </hide></showhide>

Reference

  1. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, and Tsien RY. . pmid:15558047. PubMed HubMed [Tsien]
Personal tools