TdTomato

From OpenWetWare

Revision as of 21:07, 18 March 2007 by Austin J. Che (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Sequence

atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggag ggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac atcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatc cccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc gaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc tacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaag accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc atctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctg gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc gcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgc atggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccc tacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcc tgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgcc gacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatg aacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacg ctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcag aagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctg aagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttc aagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacacc aagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctcc gagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtaa

Reference

Error fetching PMID 15558047:
  1. Error fetching PMID 15558047: [Tsien]
Personal tools