Template:SBB09 15954
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your part sequence on the part document
- Name your parts according to the list here
Beta Roll
Source: E. coli O157:H7 Genomic DNA, or similar
You are going to make a passenger part encoding a beta roll. For background, read PMID: 8253063 and PMID: 2839840. The nucleotide sequence of the source gene is at locus ECOHLY, but you aren't going to clone the entire CDS.
The region you want to include in your part is
tattccgtggaagaacttattgggaccacgcgtgccgacaagttttttggcagtaaatttgctgatatcttccatggcgcggatggtgatgaccatatagaaggaaatgacgggaatgaccgcttatatggtgataaaggtaatgacacactgagtggtggaaacggagatgaccagctctatggcggtgatggcaacgataagttaattgggggagcaggtaataattacctgaacggcggagatggcgatgatgagcttcaggttcagggaaattctcttgcaaaaaatgtattatccggtggaaaaggtaatgacaagctgtacggcagtgagggagcagatctgcttgatggcggagaagggaatgatcttctgaaaggtggatatggtaatgatatttat
The translation of your final part (excluding the BamHI and BglII sites should be:
YSVEELIGTTRADKFFGSKF ADIFHGADGDDHIEGNDGND RLYGDKGNDTLSGGNGDDQL YGGDGNDKLIGGAGNNYLNG GDGDDELQVQGNSLAKNVLS GGKGNDKLYGSEGADLLDGG EGNDLLKGGYGNDIY
Note that there is an internal BglII site in this sequence that must be properly removed.
This part encodes a passenger protein
Your passenger part should be of the {<part>} style (no start, no stop). There should be NO prepro sequence in your part. If your part is naturally secreted, you should encode only the active peptide. You should design your construction file to insert your part into plasmid pBca9495AK-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.
Silver-Binding Peptide AG4
Source: Synthetic
For background, read PMID: 12618805. Make a BglBrick part encoding the peptide:
NPSSLFRYLPSD
no start, no stop, in frame.
This part encodes a passenger protein
Your passenger part should be of the {<part>} style (no start, no stop). There should be NO prepro sequence in your part. If your part is naturally secreted, you should encode only the active peptide. You should design your construction file to insert your part into plasmid pBca9495AK-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.
Cellulose Binding Knottin
Source: Synthetic
You will be making a cellulose binding peptide. For background, start with PMID: 2554967. Your part should encode:
GSgptqshygqcggigysgptvcasgttcqvlnpyysqclGSG
This sequence does not include the amino acids encoded within the BglBricks polylinker. Your part should have no start, no stop, and be in frame.
This part encodes a passenger protein
Your passenger part should be of the {<part>} style (no start, no stop). There should be NO prepro sequence in your part. If your part is naturally secreted, you should encode only the active peptide. You should design your construction file to insert your part into plasmid pBca9495AK-Bca1144#5 using EcoRI and BamHI. The map of this plasmid is here.
