Template:SBB10 ConstructionFiles Chel sbb02

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (19:48, 22 February 2010) (view source)
 
Line 22: Line 22:
*Due to similarity to other part, some oligos are being replaced:
*Due to similarity to other part, some oligos are being replaced:
<pre>
<pre>
-
Construction of sbb01: N15 Protelomerase
+
Construction of sbb02: N15 Protelomerase
PCR MNF11-F/CA1472 on Bca1455 1-3              (569bp, gp=A)
PCR MNF11-F/CA1472 on Bca1455 1-3              (569bp, gp=A)

Current revision

sbb02: N15 Protelomerase

PCR MNF11-F/MNF12-R on pBca9523-Bca1455		(945 bp, gp = A) 
PCR MNF13-F/MNF14-R on pBca9523-Bca1485		(1033 bp, gp = B) 
------------- 
PCR MNF11-F/MNF14-R on A + B			(1925 bp, EcoRI/BamHI) 
Sub in pBjk2741-Bca1144 	(EcoRI/BamHI, 910+2170, L) 
Product is pBjk2741-sbb02	{<protel!} 
------------- 
MNF11-F	Forward PCR of Part 1 of sbb02	ccagtGAATTCgtccAGATCTAGCAAGGTAAAAATCGGTGAGTTG
MNF12-R	SOEing of Part1 of sbb02	ggttacgcttttatcttcactgcgTTTTTTAGCTTGCCCTGAGAAATTAACCG
MNF13-F	SOEing of Part2 of sbb02	CGGTTAATTTCTCAGGGCAAGCTAAAAAAcgcagtgaagataaaagcgtaacc
MNF14-R	Reverse PCR of Part 2 of sbb02	gcagtggatccTCAGCTGTAGTACGTTTCCCATGC

JCA Notes

  • Have gtcc instead of atg in prefix location
  • Need to put part on Clotho
  • Otherwise correct
  • Internal oligos are longer than necessary, but would work
  • Due to similarity to other part, some oligos are being replaced:
Construction of sbb02: N15 Protelomerase

PCR MNF11-F/CA1472 on Bca1455 1-3               (569bp, gp=A)
PCR ca1461/BDBn15001R on Bca1455 1-1		(762bp, gp=B)
PCR BDBn15002F/BDBn15002R on Bca1485 2-1	(1023 bp, gp=C)
--------------------------------------------------------------
PCR BDBn15001F/BDBn15002R on A+B+C		(1924 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144				(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb01	{rbs.part!}

MNF11-F	Forward PCR of Part 1 of sbb02	
ccagtGAATTCatgAGATCTAGCAAGGTAAAAATCGGTGAGTTG
CA1461	GGAAAGGATTGCAGAAAAGAATAACCGCGAATACTTTTAACGCCTATATGA	
PCA assembly of protelomerasefiveprime (Bca1455)
CA1472	TTGTTGGAATAACTTATAAAGATAGTCACGGCGCTCCTTCCAATCATCACT	
PCA assembly of protelomerasefiveprime (Bca1455)
BDBn15001R	Reverse retrieval and SOE-site introduciton on Bca1455
CGCTTTTATCTTCACTGCGTTTTTTAGCTTGCCCTGAG
BDBn15002F	Forward retrieval and SOE-site introduciton on Bca1485
CTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCG
BDBn15002R	Reverse retrieval and BioBricking on Bca1485
CTGATggatccttaGCTGTAGTACGTTTCCCATGCGG

part:  
GATCTAGCAAGGTAAAAATCGGTGAGTTGATCAACACGCTTGTGAATGAGGTAGAGGCCATTGATGCCTCAGACCGCCCACAAGGCGACAAAACGAAGAGAATTAAAGCCGCAGCCGCACGGTATAAGAACGCGTTATTTAATGATAAAAGAAAGTTCCGTGGGAAAGGATTGCAGAAAAGAATAACCGCGAATACTTTTAACGCCTATATGAGCAGGGCAAGAAAGCGGTTTGATGATAAATTACATCATAGCTTTGATAAAAATATTAATAAATTATCGGAAAAGTATCCTCTTTACAGCGAAGAATTATCTTCATGGCTTTCTATGCCTACGGCTAATATTCGCCAGCACATGTCATCGTTACAATCTAAATTGAAAGAAATAATGCCGCTTGCCGAAGAGTTATCAAATGTAAGAATAGGCTCTAAAGGCAGTGATGCAAAAATAGCAAGACTAATAAAAAAATATCCAGATTGGAGTTTTGCTCTTAGTGATTTAAACAGTGATGATTGGAAGGAGCGCCGTGACTATCTTTATAAGTTATTCCAACAAGGCTCTGCGTTGTTAGAAGAACTACACCAGCTCAAGGTCAACCATGAGGTTCTGTACCATCTCCAGCTAAGCCCTGCGGAGCGTACATCTATACAGCAACGATGGGCCGATGTTCTGCGCGAGAAGAAGCGTAATGTTGTGGTTATTGACTACCCAACATACATGCAGTCTATCTATGATATTTTGAATAATCCTGCGACTTTATTTAGTTTAAACACTCGTTCTGGAATGGCACCTTTGGCCTTTGCTCTGGCTGCGGTATCAGGGCGAAGAATGATTGAGATAATGTTTCAGGGTGAATTTGCCGTTTCAGGAAAGTATACGGTTAATTTCTCAGGGCAAGCTAAAAAACGCAGTGAAGATAAAAGCGTAACCAGAACGATTTATACTTTATGCGAAGCAAAATTATTCGTTGAATTATTAACAGAATTGCGTTCTTGCTCTGCTGCATCTGATTTCGATGAGGTTGTTAAAGGATATGGAAAGGATGATACAAGGTCTGAGAACGGCAGGATAAATGCTATTTTAGCAAAAGCATTTAACCCTTGGGTTAAATCATTTTTCGGCGATGACCGTCGTGTTTATAAAGATAGCCGCGCTATTTACGCTCGCATCGCTTATGAGATGTTCTTCCGCGTCGATCCACGGTGGAAAAACGTCGACGAGGATGTGTTCTTCATGGAGATTCTCGGACACGACGATGAGAACACCCAGCTGCACTATAAGCAGTTCAAGCTGGCCAACTTTTCCAGAACCTGGCGACCGGAAGTTGGGGATGAAAACACCAGGCTGGTGGCTCTCCAGAAACTGGACGATGAAATGCCAGGCTTTGCCAGAGGTGACGCTGGCGTCCGTCTCCATGAAACCGTTAAGCAGCTGGTGGAGCAGGACCCATCAGCAAAAATAACCAACAGCACTCTCCGGGCCTTTAAATTTAGCCCGACGATGATTAGCCGGTACCTGGAGTTTGCCGCTGATGCATTGGGGCAGTTCGTTGGCGAGAACGGGCAGTGGCAGCTCAAGATAGAGACACCTGCAATCGTCCTGCCTGATGAAGAATCCGTTGAGACCATCGACGAACCGGATGATGAGTCCCAAGACGACGAGCTGGATGAAGATGAAATTGAGCTCGACGAGGGTGGCGGCGATGAACCAACCGAAGAGGAAGGGCCAGAAGAACATCAGCCAACTGCTCTAAAACCCGTCTTCAAGCCTGCAAAAAATAACGGGGACGGAACGTACAAGATAGAGTTTGAATACGATGGAAAGCATTATGCCTGGTCCGGCCCCGCCGATAGCCCTATGGCCGCAATGCGATCCGCATGGGAAACGTACTACAGCTAAG
Personal tools