Template:SBB12 part sbb1202

Partname:     sbb1202
Featurename:  AraC
Genename:     araC
Source:       Escherichia coli

Crystal structure is 2ARC in PDB. Should bind arabinose. Sequence available from plasmid pBAD-T4L.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.

Construction File

PCR osbb1202F/osbb1202R on pBAD-T4L   (916bp, pcrpdt)
Digest pcrpdt                         (NheI/BamHI, L, pcrdig)
Digest PBca9525-Bca1834               (NheI/BamHI, L, vectdig)
Ligate pcrdig and vectdig             (pBca9525-sbb1202)
----
>osbb1202F	
CCATAgctagcGGCAGTGGATCTGGTagtGCTGAAGCGCAAAATGATCC	
>osbb1202R	
GACATGGATCCTTATGACAACTTGACGGCTAC
.	

>pcrpdt
CCATAGCTAGCGGCAGTGGATCTGGTAGTGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCGTTTAATGCCCATCTGGTGGCGGGTTTAACGCCGATTGAGGCCAACGGTTATCTCGATTTTTTTATCGACCGACCGCTGGGAATGAAAGGTTATATTCTCAATCTCACCATTCGCGGTCAGGGGGTGGTGAAAAATCAGGGACGAGAATTTGTTTGCCGACCGGGTGATATTTTGCTGTTCCCGCCAGGAGAGATTCATCACTACGGTCGTCATCCGGAGGCTCGCGAATGGTATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATGGCTTAACTGGCCGTCAATATTTGCCAATACGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCGCATTTCAGCGACCTGTTTGGGCAAATCATTAACGCCGGGCAAGGGGAAGGGCGCTATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTACTGCGGCGCATGGAAGCGATTAACGAGTCGCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTTGTCAGTACATCAGCGATCACCTGGCAGACAGCAATTTTGATATCGCCAGCGTCGCACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATCTTTTCCGCCAGCAGTTAGGGATTAGCGTCTTAAGCTGGCGCGAGGACCAACGTATCAGCCAGGCGAAGCTGCTTTTGAGCACCACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGTTTTGACGATCAACTCTATTTCTCGCGGGTATTTAAAAAATGCACCGGGGCCAGCCCGAGCGAGTTCCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCATAAGGATCCATGTC