Template:SBB12 part sbb1218

Partname:     sbb1218
Featurename:  cI-N-bOBP-B
Genename:     cI, bOBP
Source:       Lambda phage / cow

This one is a little different. You aren't putting a homodimer onto ToxR; you're building out a different homodimerization system. You're replacing ToxR with a different dimerization reporter, and then fusing it with bOBP, a homodimer, which hopefully will do something in response to a chemical ligand. This one is the cI transcription repressor from lambda phage, which has been shown to do similar reporting of homodimerization as is reported for ToxR (see PMID 10411275). You'll need to carefully read this paper to determine how much of cI to include in your system -- you probably don't want 100% of the ORF for this part.

Your final construct should be a normal BglBricks part in plasmid pBca9525. You most likely will want to piece the part together from two pcr products using SOEing to get something like:

 EcoRI-BglII-Pcon.rbs.cI-spacer-NheI-spacer-bOBP!-BamHI

The cI construct can be amplified from pBca9145-jtk2768. The NheI-spacer-bOBP!-BamHI cassette is available from pBca9525-Bca1835.

In designing the junction between cI and the NheI site, you should make the spacer and frame match those of the ToxR constructs (see this illustration).

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

not acutally done!!!!!!!!

Construction File

PCR ca998/osbbl333R on pBca9145-jtk2768      (643bp, A)
PCR osbbl333F/g00101 on pBca9525-Bca1832     (1438bp, B)
PCR ca998/g00101 on A+B                      (2059bp, pcrpdt)
Digest pcrpdt                                (EcoRI/BamHI, L, pcrdig)
Digest pBca9525-Bca1834                      (EcoRI/BamHI, L, vectdig)
Ligate pcrdig and vectdig, product is pBca9525-sbb1217
----
>ca998
gtatcacgaggcagaatttcag
>osbbl333R
ctAGATCCACTGCCgctagcAGATCCgcttggcttggagcc
>osbbl333F
CTgctagcGGCAGTGGATCTag
>g00101
attaccgcctttgagtgagc
>pcrpdt