Template:SBB12 part sbb1219

Partname:     sbb1219
Description:  P_R-AmilCP
Genename:     P_R, AmilCP
Source:       Lambda phage / synthetic

You are going to make an AmilCP reporter of the P_R promoter from lambda phage. This promoter shuts down when bound to CI protein. The sequence of the P_R part, which is present in pBjk2741-jtk2801 is:

 GATCTtaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcG

You can get the PglpT-AmilCP fragment from plasmid pBjk2741-jtk3346. What you want to make is BglBrick part that would result from joining the P_R part with the rbs.AmilCP part. However, you'll be making the construct by SOEing. In designing your construction file for this, note that the P_R part is really short, and things will go better if you use oligo ca998 as the forward external oligo instead of some annealing region that binds within the part. Ask JCA if that doesn't make sense.

The vector for your final product should be pBgl00001, and you can use plasmid pBgl00001-Bjk2828. Note that this plasmid has a p15A origin of replication, and as such is much lower copy than most other parts you'll work with. As a result, you won't get much material in your minipreps, and you should adjust things accordingly.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.

Construction File

PCR ca998/jw000R on pBjk2741-jtk2801	(160 bp, proprd)
PCR jw000F/g00101 on pBjk2741-jtk3346	(710 bp, amiprd)
PCR ca998/g00101 on proprd+amiprd	(951 bp, pcrpdt)
Digest pcrpdt				(EcoRI/BamHI, L, pcrdig)
Digest pBgl00001-Bjk2828		(EcoRI/BamHI, L, vectdig)
Ligate pcrdig and vectdig		(pBgl00001-sbb1219)
----
>ca998
gtatcacgaggcagaatttcag
>g00101
attaccgcctttgagtgagc
>jw000R	Reverse internal annealing for purification of P_R part
gttaaattagtcAGATCCgcaacc
>jw000F	Forward internal annealing for purification of rbs.AmilCP
ggttgcGGATCTgactaatttaac
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATCTGAAGTGGAATTCATGAGATCTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCGGATCTGACTAATTTAACGAGGAGGATTTCATGAGTGTGATCGCTAAACAAATGACCTACAAGGTTTATATGTCAGGCACGGTCAATGGACACTACTTTGAGGTCGAAGGCGATGGAAAAGGTAAGCCCTACGAGGGGGAGCAGACGGTAAAGCTCACTGTCACCAAGGGCGGACCTCTGCCATTTGCTTGGGATATTTTATCACCACAGTGTCAGTACGGAAGCATACCATTCACCAAGTACCCTGAAGACATCCCTGACTATGTAAAGCAGTCATTCCCGGAGGGCTATACATGGGAGAGGATCATGAACTTTGAAGATGGTGCAGTGTGTACTGTCAGCAATGATTCCAGCATCCAAGGCAACTGTTTCATCTACCATGTCAAGTTCTCTGGTTTGAACTTTCCTCCCAATGGACCTGTCATGCAGAAGAAGACACAGGGCTGGGAACCCAACACTGAGCGTCTCTTTGCACGAGATGGAATGCTGCTAGGAAACAACTTTATGGCTCTGAAGTTAGAAGGAGGCGGTCACTATTTGTGTGAATTTAAAACTACTTACAAGGCAAAGAAGCCTGTGAAGATGCCAGGGTATCACTATGTTGACCGCAAACTGGATGTAACCAATCACAACAAGGATTACACTTCGGTTGAGCAGTGTGAAATTTCCATTGCACGCAAACCTGTGGTCGCCTAATAAGGATCCTAACTCGCTCCTCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT