Template:SBB12 part sbb1221

From OpenWetWare
Revision as of 21:50, 13 February 2012 by JCAnderson (talk | contribs) (→‎Construction File)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
Partname:     sbb1221
Description:  P_R-Bla
Genename:     P_R, Bla
Source:       Lambda phage / synthetic

You are going to make a Bla reporter of the P_R promoter from lambda phage. This promoter shuts down when bound to CI protein. Bla confers ampicillin resistance when expressed, and it can also be assayed biochemically. The sequence of the P_R part, which is present in pBjk2741-jtk2801 is:

 GATCTtaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcG

You can get the rbs.Bla part from plasmid pBgl00001-Brp0006. What you want to make is a BglBrick part that would result from joining the P_R part with the rbs.Bla part. However, you'll be making the construct by SOEing. In designing your construction file for this, note that the P_R part is really short, and things will go better if you use oligo ca998 as the forward external oligo instead of some annealing region that binds within the part. Ask JCA if that doesn't make sense.

The vector for your final product should be pBgl00001, and you can use plasmid pBgl00001-Bjk2828. Note that this plasmid has a p15A origin of replication, and as such is much lower copy than most other parts you'll work with. As a result, you won't get much material in your minipreps, and you should adjust things accordingly.

Genomic or plasmid DNA with this feature is available

Either genomic DNA or plasmid DNA is available for this sequence. Use your usual considerations of size and number of internal restriction sites to decide whether you should use that template for construction. You'll also need to think through which polymerase to use in making the construct.


Construction File

PCR ca998/gfRevPR on pBjk2741-jtk2801	    	(160bp, A)
PCR dc5002/g00101 on pBgl00001-Brp0006    	(1100bp, B)
PCR ca998/g00101 on A+B         		(1236bp, pcrpdt)
Digest pcrpdt                    		(EcoRI/BamHI, L, pcrdig)
Digest pBgl00001-Bjk2828         		(EcoRI/BamHI, L, plasdig)
Ligate pcrdig and plasdig, product is pBgl00001-sbb1221
----
>ca998	Forward external annealing for purification of P_R part
gtatcacgaggcagaatttcag
>dc5002 Forward PCR of rbs.Bla
ggcggtgataatggttgcGGATCTtacgacgggAAGC
>gfRevPR
AGATCCgcaaccattatcacc
>pcrpdt
GTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATCTGAAGTGGAATTCATGAGATCTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCGGATCTTACGACGGGAAGCTTAAATCCTAATGGTTTATTTTGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTGGATCCTAACTCGCTCCTCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAAT